| CB6992 |
bus-5(br19) pgp-3(pk18) X. |
Hypersensitive to drugs. Resistant to infection by M. nematophilum and Leucobacter Verde2. Hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al. (in preparation). |
| CB7007 |
ilys-3(ok3222) IV. |
Viable, but defective in bacterial grinding and hypersensitive to bacterial pathogens. Derived by out-crossing parental strain VC2496. Reference: Gravato-Nobre et al. (2016) PMID: 27525822. |
| CB7080 |
eEx754. |
eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822. |
| CB7101 |
dhs-29(e3014) X. |
Skiddy, bleach-sensitive hermaphrodites. Resistant to infection by Leucobacter Verde1. Reference: O'Rourke et al. (in preparation). |
| CB7109 |
acs-20(e3031) IV; him-5(e1490) V. |
Him. Skiddy, bleach-sensitive hermaphrodites and males. Resistant to Leucobacter Verde1. Reference: O'Rourke et al. (in preparation). |
| CB7171 |
tra-1(e1099) subs-4(e3026) III; eDp6 (III;f). |
Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation). |
| CB7172 |
ilys-3(ok3222) IV; lys-7(oj1385) V. |
Viable, poor bacterial grinding, increased sensitivity to bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822. |
| CGC58 |
C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| JK6022 |
pgl-1(q842) IV. |
pgl-1 (q842) is a (Q342A) missense mutation. This is a homozygous strain; replaced JK5481. Reference: Aoki ST, et al. Proc Natl Acad Sci U S A. 2016 Feb 2;113(5):1279-84. |
| FT422 |
unc-119(ed3) III; xnIs178. |
xnIs178 [mCherry::pac-1 + unc-119(+)]. Translational fusion to PAC-1. mCherry::PAC-1 is expressed in pharyngeal muscle cells (mostly apical, some basal), a few cells in the vulva, maternally in early embryos at cell contacts, and at adherens junctions in late embryogenesis. Maternal expression is difficult to detect by eye but visible with longer camera exposure. Reference: Anderson DC, et al. Science 2008: 320: 1771-1774. |
| FT778 |
unc-119(ed3) III; xnIs299. |
xnIs299 [hmr-1p::hmr-1::mCherry + unc-119(+)]. Translational fusion to hmr-1. HMR-1::mCherry is visible in multiple tissues including pharynx, intestine, epidermis and gonad; also marks the adherens junctions in epithelia. No visible maternal expression. Reference: Zilberman Y, et al. 2017: J Cell Biol. (In press). |
| CGC60 |
dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs46] V. |
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9. |
| PD2217 |
ccTi1594 unc-119(ed3) III; hjSi20 IV. |
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. hjSi20 [myo-2p::mCherry::unc-54 3'UTR] IV. GFP expression in germline. mCherry expression in pharynx. The ccTi1594 transgene rescues unc-119(ed3). High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2218 |
ccTi1594 umnIs7 III. |
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2220 |
ccTi1594 umnIs27 III. |
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs27 [myo-2::GFP + NeoR, III: 8856215 (intergenic)] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2224 |
oxIs322 II; ccTi1594 umnIs7 III. |
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)] II. ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. mCherry expression in pharyngeal and body wall muscle nuclei. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2227 |
oxIs322 II; ccTi1594 III. |
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)] II. ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. mCherry expression in pharyngeal and body wall muscle nuclei. GFP expression in germline. High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD1594 |
ccTi1594 unc-119(ed3) III. |
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| CB7173 |
ilys-3(ok3222) IV; ilys-5(tm3151) X. |
Viable, but with poor bacterial grinding and increased susceptibility to some bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822. |
| CB7174 |
ptr-15(e2710e3062) V. |
Intragenic missense revertant. Partly resistant to Leucobacter Verde1. Reference: Stroud et al. (2013) IWM2013Abstract. ptr-15 also known as bus-13. |
| CB7176 |
bus-8A(lj22) dhs-29(e3066) X. |
Skiddy, bleach-sensitive, drug-sensitive. Resistant to infection by Leucobacter Verde1 and Leucobacter Verde2. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation). |
| CB7198 |
acs-20(e3031) IV. |
Bleach-sensitive, drug-sensitive, resistant to Leucobacter Verde1. Reference: O'Rourke et al (in preparation). |
| CB7212 |
unc-119(ed3) III; eEx781. |
eEx781 [ilys-6p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Transcriptional reporter for ilys-6. Reference: Gravato-Nobre et al. (2016) PMID: 27525822. |
| CB7259 |
bus-8B(ok1175) X; eEx763. |
eEx763 [bus-8(exon2stop) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(ok1175) rescued by modified bus-8(+) transgene. Reference: O'Rourke et al (in preparation). |
| CB7401 |
unc-119(ed3) III; bah-2(gk487599) IV; eEx835. |
eEx835 [bah-2(+) + unc-119(+)]. Pick wild-type to maintain. bah-2(gk487599) rescued by transgene. Reference: O'Rourke et al (in preparation). |
| CB7427 |
unc-17(e245) IV; eEx849. |
eEx849 [C28H8.4(sdmV186E)]. unc-17 missense mutant suppressed by missense C28H8.4 transgene. Pick non-Unc hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation). |
| CB7430 |
unc-17(e245) IV; eEx855. |
eEx855 [erd-2(sdmV186E) + sur-5p::GFP]. unc-17 missense mutant partly suppressed by missense erd-2 (a.k.a. sup-2) transgene. Pick GFP+ (weak Unc) hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation). |
| CB7448 |
bus-5(e3133) X. |
Slightly skiddy, bleach-sensitive, drug-sensitive, Bus (M. nematophilum resistant), Bah (Yersinia biofilm resistant), Leucobacter Verde1 hypersensitive. CRISPR/Cas9-induced deletion. Reference: O'Rourke et al (in preparation). |
| CB7191 |
srf-5(gk424525) X. |
Bus (M. nematophilum resistant). Weakly resistant to Leucobacter Verde2; hypersensitive to Leucobacter Verde1. Weak missense allele (C59Y). Reference: O'Rourke et al (in preparation). |
| CZ8332 |
juIs223 IV. |
juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. |
| EAK102 |
eeeIs1. |
eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.] |
| EAK103 |
eeeIs2. |
eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.] |
| CB6129 |
dpy-27(rh18) III; fem-1(hc17) IV. [4A;3X] |
Temperature-sensitive: Maintain at 15C. Stable, temperature-sensitive tetraploid strain: fertile 4A;3X hermaphrodites and 4A;2X males at 15C; fertile 4A;3X females and feminized sterile 4A;2X males at 25C. Reference: Hodgkin (2002) PMID: 12399387. |
| CB6233 |
dpy-17(e2898) dpy-31(e2770) III. |
Viable dumpy. Suppressor allele of dpy-17: lethality of dpy-31(e2770) suppressed by e2898. Reference: Novelli et al. (2006) PMID: 16452136. |
| CB6453 |
dpy-31(e2770) unc-119(ed3) III; eIs101. |
eIs101 [dpy-17(E301K) + unc-119(+)]. Weakly dumpy, non-Unc. dpy-31 lethality suppressed by integrated dpy-17(gf) transgene. Reference: Novelli et al. (2006) PMID: 16452136. |
| CB6725 |
unc-119(ed3); eEx655. |
eEx655 [ilys-2p::CFP; unc-119(+)]. Pick wild-type (non-Unc) to maintain. Transgenic animals carry ilys-2 transcriptional reporter. Reference: Gravato-Nobre et al. (2016) PMID: 27525822. |
| CB6734 |
clec-60(tm2319) II. |
No obvious phenotype. Reference: O’Rourke et al. (2005) PMID: 16809667. |
| CB6755 |
osr-1(ok959) I; glf-1(tm2412) IV. |
Maintain at 15C. Small, sluggish, slow-growing fragile hermaphrodites. Almost inviable above 20C. Reference: Novelli et al. (2009) PMID: 19751718. |
| CB6785 |
unc-119(ed3) III; eEx650. |
eEx650 [ilys-4p::GFP + unc-119(+)]. Transcriptional reporter for ilys-4. Reference: Gravato-Nobre et al. (2016) PMID: 27525822. |
| CB6991 |
mrp-1(pk89) bus-5(br19) X. |
Skiddy hermaphrodites, bleach-sensitive, drug-hypersensitive, abnormal bacterial pathogen resistance. Reference: Stroud et al (in preparation). |
| CB6253 |
bus-8B(e2992) X; eEx541. |
eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(e2892) animals are viable on Leucobacter Verde1, unlike most other bus-8 mutants. References: Partridge et al. (2008) PMID: 18395708. Stroud et al (in preparation). |
| CB7151 |
him-8(e1489) IV; ptr-15(e2710) V. |
Him. Bus (resistant to M. nematophilum); hypersensitive to Leucobacter Verde1. References: Gravato-Nobre et al. (2005) PMID: 16079230. Hodgkin et al (in preparation). |
| CB7177 |
bus-8A&B(lj22e3067) X. |
Small, skiddy, slow-growing, bleach-sensitive; resistant to Leucobacter Verde1. Intragenic pseudorevertant of bus-8(lj22), P63L = KLHPGDWW> KLHLGDWW. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation). |
| CB7403 |
bah-3(br9) I; bah-2(gk487599) IV. |
Bah (resistant to Yersinia biofilm formation). Reference: Hodgkin et al (in preparation). |
| CB7410 |
bah-1(ok2197) I; bah-2(gk487599) IV. |
Bah (resistant to Yersinia biofilm formation). Reference: Hodgkin et al (in preparation). |
| CB7425 |
him-5(e1490) V; bus-25(e3094) X. |
Him. Small, slow-growing, bleach-sensitive; Bus (resistant to M. nematophilum), slightly resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: Hodgkin et al (in preparation). |
| CB7468 |
acs-22(gk373989) X. |
No obvious phenotype; derived from VC20689. Reference: O'Rourke et al (in preparation). |
| CB7181 |
bus-8B(e2883e3071) X. |
Weak Bus, viable on Leucobacter Verde1. e3071 is a missense intragenic revertant (P97S) of e2883 (G378E). Reference: Stroud et al (in preparation). |
| CB7422 |
bus-22(e3108) subs-4(e3048) III. |
Viable, small, slow-growing, bleach-sensitive, resistant to Leucobacter Verde1 and Leucobacter Verde2. Lethality of subs-4(e3048) suppressed by bus-22(e3108) mutation. Reference: O'Rourke et al (in preparation). |
| AQ351 |
bus-8A(lj22) X. |
Skiddy, bleach-sensitive, drug-sensitive, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: Partridge et al. (2008) PMID: 18395708. |