| RG3002 |
sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3003 |
sra-3(ve503[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3004 |
sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3005 |
Y65B4BL.1(ve505[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3006 |
sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3007 |
sra-28(ve507[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3008 |
sra-29(ve508[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3009 |
sra-20(ve509[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCGAAAGCTTAAGATGCGCTTCCGAAG ; Right flanking sequence: ctatcaatcctccttctttattttatcatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3010 |
sra-18(ve510[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| XE1024 |
daf-2(e1370) III; oxIs12 X. |
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Higher axon regeneration in aged animals. Reference: Byrne AB, et al. Neuron. 2014; 81(3):561-73. |
| XE1026 |
sup-17(n316) I; oxIs12. |
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Neuron. 2012 Jan 26;73(2):268-78. |
| XE1037 |
geIs3 I; dpy-11(e224) V; oxIs12 X. |
geIs3 [sir-2.1(+) + rol-6(su1006)] I. oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Rollers. Dpy. Reference: Byrne AB, et al. Neuron. 2014; 81(3):561-73. |
| XE1065 |
sup-17(n316) I; oxIs12 X ; wpEx16. |
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx16 [unc-47p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. GABAergic expression of SUP-17 from wpEx16 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78. |
| XE1089 |
sup-17(n316) I; oxIs12 X; wpEx22. |
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx22 [myo-3p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. Muscular expression of SUP-17 from wpEx22 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78. |
| XE1090 |
sup-17(n316) I; oxIs12 X; wpEx30. |
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx30 [pdi-2p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. Hypodermal expression of SUP-17 from wpEx30 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78. |
| XE1873 |
aex-6(sa24) I; oxIs12 X. |
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. aex-6 a.k.a. rab-27. Reference: Sekine Y, et al. Cell reports. 2018; 23(2):415-428. |
| XE1892 |
wpEx287. |
wpEx287 [unc-47p::aex-6::unc-54 3'UTR + myo-2p::mCherry]. Pick mCherry+ to maintain. aex-6 a.k.a. rab-27. Reference: Sekine Y, et al. Cell reports. 2018; 23(2):415-428. |
| XE1910 |
aex-6(sa699) I; oxIs12 X. |
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. High regeneration. aex-6 a.k.a. rab-27. Reference: Sekine Y, et al. Cell reports. 2018; 23(2):415-428. |
| XE1311 |
mkk-4(ju91) X; vtIs7. |
vtIs7 [dat-1p::GFP]. GFP expression in dopaminergic neurons. This strain was generated by crossing the mkk-4(jk91) mutation into the vtIs7 background. Reference: Gonzalez-Hunt CP, et al. PLoS One. 2014 Dec 8;9(12):e114459. |
| OH15373 |
otIs683. |
otIs683 [hlh-4(fosmid)::YFP + ttx-3p::mCherry]. Transgene is expressed in ADL neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979. |
| MLC113 |
ttTi5606 mir-236(luc2[unc-119(+)]) II; unc-119(ed3) III. |
Superficially wild-type. CRISPR/Cas9-engineered mir-236 deletion allele; miRNA hairpin replaced by unc-119. |
| MLC349 |
ttTi5606 II; unc-119(ed3) III; mir-1820(luc16[unc-119(+)]) IV. |
Superficially wild-type. CRISPR/Cas9-engineered mir-1820 deletion allele; miRNA hairpin replaced by unc-119. |
| MLC425 |
mir-4813(luc21) III. |
Superficially wild-type. CRISPR/Cas9-engineered mir-4813 seed mutant: ttcaatat to tGCGCat (introduced FspA1 cutting site) and inserted additional PAM mutation in the upstream region. |
| MLC698 |
mir-255(luc38) V. |
Superficially wild-type. CRISPR/Cas9-engineered mir-255 deletion allele removes the hairpin (breakpoints: aaactttcgttgctgcgaaat...ccattcaattaatttcccgcatttcttaatttttgagctttttctt). |
| MLC1384 |
mir-1(luc108) I. |
Superficially wild-type. CRISPR/Cas9-engineered mir-1 deletion allele (breakpoints: gcagaaaattactcaccattaaaacactaccacc |
| LBV2 |
nstp-3(ejd2) V. |
DEET-resistant. ejd2 causes a F48V substitution in nstp-3. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123. |
| LBV3 |
str-217(ejd3) V. |
DEET-resistant. ejd3 causes a P314S substitution in str-217. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123. |
| LBV5 |
str-217(ejd1) V. |
DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA
|
| CGC94 |
hIn1 [umnIs75] I. |
umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::GFP transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9. |
| CZ13799 |
juIs76 II. |
juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76. |
| IG1335 |
frEx479. |
frEx479 [F57F4.4p::GFP + col-12p::DsRed]. Pick DsRed+ animals to maintain array. Constitutive GFP expression in posterior intestinal cells induced upon infection with Photorhabdus luminescens in posterior intestinal cells. Reference: Julien-Gau I, et al. Dev Comp Immunol. 2014 Feb;42(2):132-7. |
| SOZ259 |
prx-10(ssd68) |
Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag . |
| ZM8230 |
ubr-1(hp684) I. |
hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303. |
| SOZ511 |
emb-8(ssd89) III. |
emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. |
| RG3011 |
sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3012 |
sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3013 |
sra-22(ve513[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3014 |
sra-37(ve514[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 2317 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaataaTTATACTGACGCGTATTTGCTG ; Right flanking sequence: CATtatggtctcatgaagtgctgctggaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3015 |
sra-12(ve515[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3016 |
sra-26(ve516[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1961 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTCATATGAGAATCCAGATCTCCATA ; Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3017 |
sra-9(ve517[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcagtttcaagatttcATGGCTACCATAG ; Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3018 |
sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| SSM264 |
rad-51(iow53[GFP::rad-51]) IV/nT1[qIs51] (IV;V). |
Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764. |
| RG3019 |
sra-32(ve519[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3020 |
sra-24(ve520[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| QC142 |
fld-1(et45) I; paqr-2(tm3410) mdt-15(et14) III. |
No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2. |
| QC145 |
fld-1(et48) I; paqr-2(tm3410) mdt-15(et14) III. |
No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2. |
| QC146 |
fld-1(et49) I; iglr-2(et34) III. |
The fld-1 mutation acts as a suppressor of iglr-2 but the strain still displays weak version of the iglr-2 phenotypes including reduced growth in the presence of glucose or at 15°C, and occasionally produces a tail tip defect. |
| PHX649 |
fat-6(syb649[fat-6::GFP]) IV. |
GFP tag inserted into endogenous fat-6 locus using Crispr/Cas9. fat-6::GFP expression in intestine and hypodermis. No obvious phenotype, but the fat-6 locus is likely inactive in this strain. Reference: Bodhicharla R, et al. Genetics. 2018 Sep;210(1):189-201. |
| UTR43 |
par-4(nar12[par-4Ap::mNG + loxP sqt-1(gf) Hygromycin(+) loxP 3X FLAG]) V. |
Homozygous viable, Rol. nar12 (non-excised strain) is null for par-4A & C, but not for par-4B, and is viable. Low rate of spontaneous excision even when maintained at 15C. Pick Rollers to maintain. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html |
