| JDW794 |
dpy-14(wrd229 wrd325[dpy-14::mScarlet::2xOLLAS) I. |
mScarlet::2xOLLAS tag inserted at the C-terminus of the endogenous dpy-14 locus by CRISPR. Generated by replacing mNG::3xFLAG with mScarlet::2xOLLAS in parental strain JDW651. |
| IG2212 |
spia-1(fr201[spia-1::mNG(internal)::3xFLAG] X. |
Internal mNeonGreen::3xFLAG tags inserted into endogenous spia-1 locus. |
| CB7505 |
him-8(e1489) IV; ptr-15(cr52) V; eEx730. |
eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Him. Lethal 1118bp deletion allele of ptr-15 rescued by eEx730. Non-GFP animals will be dead eggs and dead hatchlings. References: O’Rourke et al. (in revision 2024), Kuwabara et al. (in prep.) |
| CB7517 |
ptr-15(cr52) lon-3(e2175) V; eEx730. |
eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lon. Non-GFP animals will mostly be dead eggs and dead hatchlings, but can segregate rare GFP-negative viable ptr-15 lon-3 homozygotes (which are fertile but grow very poorly). Reference: Kuwabara et al. (in prep.) |
| CB7587 |
ptr-15(gk5234) V; crEx498. |
crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3’UTR + rps-27p::neoR::unc-54 3’UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: O’Rourke et al. (in revision 2024). |
| CSM1320 |
twk-2(mac507) II. |
twk-2 loss-of-function allele. Moderately deep curvature. Weakly extended backward locomotion. Frequent backward locomotion. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| CSM1323 |
twk-7(mac510) III. |
twk-7 loss-of-function allele. Hyperactive forward locomotion. twk-7(mac510) is a 10-bp deletion and 2-bp insertion in exon 9, causing a frameshift: aatttattttcagGTAAAAAAGAACGCAGCAACGGAGACATGGACATTTTCATCGTCCATTTTCTTTGCCGTAACCGTCGTCACTACCATCGGATACGGTAATCCAGTTCCAGTGACAAACATTGGACGGATATGGTGTATATTGTTCTCCTTGCTTGGAA(TACCTCTAAC)del(AA)insACTGGTTACCATCGCTGACTTGGgtaagtgg. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| CSM1331 |
twk-43(mac518) V. |
twk-43 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| CSM1358 |
twk-29(mac527) I. |
twk-29 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| CSM1360 |
twk-30(mac529) I. |
twk-30 loss-of-function allele. Extended backward locomotion. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| CSM1362 |
twk-35(mac531) V. |
twk-35 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| CSM1364 |
twk-48(mac533) III. |
twk-48 loss-of-function allele. Irregular curvature. Frequent deep forward turns. Brief forward coiling upon completing backward locomotion. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| CSM1366 |
twk-49(mac535) II. |
twk-49 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| CSM1356 |
twk-26(mac525) X. |
twk-26 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| OK590 |
cuEx467. |
cuEx467 [ser-7::GFP + rol-6(su1006)]. Pick Rollers to maintain. Expresses GFP exclusively in the M4 pharyngeal neuron. Reference: Ray P, et al. Dev Neurobiol. 2008 68(4): p. 421-33. PMID 18161854. |
| OH16445 |
cdh-1(ot1034) III. |
CRISPR/Cas9 engineered deletion of full cdh-1 locus. |
| OH16446 |
cdh-3(ot1035) III. |
CRISPR/Cas9 engineered deletion of full cdh-3 locus. |
| OH17994 |
cdh-4(ot1246) III. |
CRISPR/Cas9 engineered deletion of full cdh-4 locus. |
| OH16750 |
cdh-8(ot1084) IV. |
CRISPR/Cas9 engineered deletion of full cdh-8 locus. |
| OH17995 |
cdh-9(ot1247) X. |
CRISPR/Cas9 engineered deletion of full cdh-9 locus. |
| OH16773 |
cdh-12(ot1091) III. |
CRISPR/Cas9 engineered deletion of full cdh-12 locus. |
| OH16739 |
casy-1(ot1082) II. |
CRISPR/Cas9 engineered deletion of full casy-1 locus. |
| OH16772 |
fmi-1(ot1090) V. |
CRISPR/Cas9 engineered deletion of full fmi-1 locus. |
| PHX4454 |
hmr-1(syb4454 [hmr-1::SL2::GFP::H2B]) I. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous hmr-1 locus. |
| OH16774 |
cdh-1(ot1092[cdh-1::T2A::GFP::H2B]) III. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-1 locus. |
| OH17000 |
cdh-3(ot1096[cdh-3::T2A::GFP::H2B]) III. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-3 locus. |
| PHX4476 |
cdh-4(syb4476[cdh-4::SL2::GFP::H2B]) III. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus. |
| OH17058 |
cdh-5(ot1127[cdh-5::T2A::GFP::H2B]) IV. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus. |
| OH16830 |
cdh-8(ot1106[cdh-8::T2A::GFP::H2B]) IV. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-7 locus. |
| OH16783 |
cdh-9(ot1095[cdh-9::T2A::GFP::H2B]) X. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-9 locus. |
| OH17002 |
cdh-10(ot1118[cdh-10::T2A::GFP::H2B]) IV. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-10 locus. |
| OH17030 |
cdh-12(ot1119[cdh-12::T2A::GFP::H2B]) III. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-12 locus. |
| OH16932 |
casy-1(ot1108[casy-1::T2A::GFP::H2B]) II. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous casy-1 locus. |
| PHX4563 |
fmi-1(syb4563)[fmi-1::SL2::GFP::H2B]) V. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous fmi-1 locus. |
| PHX6640 |
cdh-5(syb6640[cdh-5::GFP]) IV. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus. |
| PHX6764 |
cdh-4(syb6764[cdh-4::GFP]) III. |
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus. |
| OK1020 |
cuIs36. |
cuIs36 [myo-2p::GCaMP3 + rol-6(su1006)]. Maintain at 15C. Rollers. Integrated by UV/TMP irradiation of cuEx804. Reference: Kozlova AA, et al. Genetics. 2019 May;212(1):231-243. doi: 10.1534/genetics.119.302053. PMID: 30898771. |
| OK1083 |
cuEx828. |
cuEx828 [ceh-19p::snb-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. SNB-1::GFP expression specifically marks synaptic vesicles in the MC pharyngeal neuron. Reference: Kozlova AA, et al. Genetics. 2019 May;212(1):231-243. doi: 10.1534/genetics.119.302053. PMID: 30898771. |
| OK1097 |
tbx-2(cu32[tbx-2::TY1::GFP::FLAG]) III. |
TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of the endogenous tbx-2 coding sequence by CRISPR/Cas9 genome editing. |
| OK461 |
bcl-11(cu10)/unc-46(e177) dpy-11(e224) V. |
Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https://hdl.handle.net/10027/12060 |
| OK1114 |
tbx-2(cu37[tbx-2::TY1::GFP::FLAG *bx59]) III. |
TY1::EGFP::3xFLAG tag inserted in frame at stop codon of the endogenous mutant tbx-2(bx59) coding sequence by CRISPR/Cas9 genome editing. Maintain at 15C. Lethal at 25C. |
| RG3480 |
col-123(ve980[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 1079 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. The indel of col-123 resides within an intron of catp-6. It is not known if ve980 affects catp-6 expression or function. Left flanking Sequence: ggaaatgatgggaatattttcagagttcct ; Right flanking sequence: AGGTGGAGGCGGCGGAGGCGGAGAATACAA. col-123 sgRNA A: ATGACACTTGCATtctatac; col-123 sgRNA B: TCTCATGGTGGTTCATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3481 |
ech-9(ve981[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 2053 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caatttaacaaaaactgtttcaaaaaacca ; Right flanking sequence: atttgtaatatatcacgtttttactgccca. ech-9 sgRNA A: gtctgtcccgtcttttataa; ech-9 sgRNA B: gaaaagtacctataaaaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3483 |
egrh-3(ve983[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 8336 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGCTTGTGATGCTCCACCACCAGCTCCA ; Right flanking sequence: tggcctagaaaaaagttaggccaccaataa. egrh-3 crRNA A: ACGACATTTAAGCTTCAGGG; egrh-3 crRNA B: CACGCGattttctgatacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| HY123 |
nhr-31(ye123) IV. |
Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230. |
| SHG1676 |
drh-3(ust352[drh-3::GFP::3xFlag]) I. |
GFP::3xFlag inserted into endogenous drh-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG1682 |
elli-1(ust354[elli-1::GFP::3xFlag]) IV. |
GFP::3xFlag inserted into endogenous elli-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG1683 |
egc-1(ust355[egc-1::GFP::3xFlag]) III. |
GFP::3xFlag inserted into endogenous egc-1/c14b1.12 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG1685 |
egc-1(ust355[egc-1::mCherry]) III. |
mCherry inserted into endogenous egc-1/c14b1.12 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG1686 |
cgh-1(ust641[GFP::cgh-1]) III. |
GFP inserted into endogenous cgh-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Zhang Y, et al. Sci Rep. 2021 Oct 13;11(1):20359.doi: 10.1038/s41598-021-99919-0. PMID: 34645931. |
