| TV27863 |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) I; hpo-30(wy1220) V; wyIs910 X. |
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073. |
| TV27864 |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) I; hpo-30(ok2047) V; wyIs910 X. |
wyIs910 [ser-2(prom3)::flippase + unc-122::BFP]. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. ok2047 is a 1294 bp deletion in hpo-30. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073. |
| TV27873 |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) kpc-1(gk8) I; wyIs910 X. |
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073. |
| TV27876 |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) I; sax-7(nj48) IV; wyIs910 X. |
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073. |
| TV29097 |
dma-1(wy1924) I; wySi919 V. |
wySi919 [des-2p::myr-mScarlet::let-858 3'UTR] V. dma-1(wy1924) is a deletion allele removing LRR. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073. |
| TV29856 |
kpc-1(gk8) I; wyIs592 III. |
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. gk8 is a punitive null allele of kpc-1. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073. |
| AG406 |
pezo-1(av144) IV. |
av144 is a CRISPR/Cas9 engineered deletion in the N-terminal region of pezo-1 removing exons 1–13. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809. |
| AG416 |
pezo-1(av149) IV. |
av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (27–33) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809. |
| CYA15 |
rexEx7. |
rexEx7 [gpa-4p::gfp::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in two ASI neurons. |
| CYA16 |
rexEx8. |
rexEx8 [sur-5p::GFP::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in somatic cells. |
| CYA17 |
rexEx9. |
rexEx9 [hlh-8p::GFP::halo + rol-6(su1006)]. Pick Rollers to maintain. GFP expression in M and undifferentiated cells of the M lineage. |
| CYA18 |
rexEx10. |
rexEx10 [hsp-16p::his-6::Halo + mec-7p::mRFP]. Pick RFP+ to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces the expression of Halo protein. |
| CYA19 |
dvIs19 III; rexEx11. |
dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type. |
| CYA20 |
dvIs19 III; rexEx12. |
dvIs19 [gst-4p::GFP::NLS] III. rexEx12 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of mCherry::Halo protein. Oxidative stress induces expression of GFP. |
| CYA21 |
dvIs19 III; rexEx13. |
dvIs19 [gst-4p::GFP::NLS] III. rexEx13 [hsp-16p::HA::wdr-23::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of HA::WDR23::Halo protein. Oxidative stress induces expression of GFP. |
| CYA22 |
ahcy-1(syb748) I. |
ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity. |
| CYA23 |
ahcy-1(syb748) I; sqIs13. |
sqIs13 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. GFP fluorescence in autophagosomes. RFP fluorescence in AWB and AWC. ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity. |
| VK3785 |
vkIs3785 X. |
vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663. |
| VK3835 |
atg-3(bp412) IV; vkIs3785 X. |
vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. Stronger GFP expression in intestine than in wild-type background. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663. |
| VK3818 |
epg-5(tm3425) II; vkIs3785 X. |
vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. GFP aggregation in intestine. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663. |
| QC159 |
cuc-1(syb1006) III. |
cuc-1 null mutant. Grows well on standard media but has a slightly reduced brood size and ~10% of gonad arms show a migration defect. Reference: Zhang X, et al. Biometals. 2020 Jun;33(2-3):147-157. doi: 10.1007/s10534-020-00239-z. PMID: 32506305. |
| PHX3258 |
nhr-49(syb3258[nhr-49::GFP]) I. |
GFP tag inserted at C-terminus of endogenous nhr-49 locus. Reference: Ruiz M, et al. Nat Commun. 2022 Nov 22;13(1):7162. doi: 10.1038/s41467-022-34931-0. PMID: 36418331. |
| RG3455 |
mcm-2(ve955[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Late larval lethal. Deletion of 5085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 animals that become increasingly unc and eventually die (ve955 homozygotes) and paralysed dpyunc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTGACATTCTCAATTCTCAATTGCTGAGCC; Right flanking sequence: CGCGATGGAGCGCGATTGCGCGGGCATGAC. mcm-2 sgRNA A: TTTTCGATGAATTCCGACTC; mcm-2 sgRNA B: ACAGAATTCAAAAGAGGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3476 |
+/nT1 [umnIs49] IV; mcm-7(ve976[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval lethal. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead translucent early larvae (ve976 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GTCTTCATATGGATAGGAACGAGGGAGCCG; Right flanking sequence: ATTCAAAGATGCGCTCGCAAGGGAATCAGC. mcm-7 sgRNA A: AAGAGAAACTTCCTCGTTGG; mcm-7 sgRNA B: GGCGTTTGAGATGGCGATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3472 |
rpc-1(ve972[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested early larvae (ve972 homozygotes, rare escapers are fertile adults), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GTCTTTCCATGAGCAACAATTTTACATCCT; Right flanking sequence: CGGCTTTTTTTACGGTTCctgaatacaaaa. rpc-1 crRNA A: AAAGTGTGTCCACAGATGAG; rpc-1 crRNA B: AATCTTCAGAACTGCTCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3475 |
eif-2Bbeta(ve975[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [umnIs78] I. |
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve975 homozygotes), and viable non-GFP mKate2+ animals (hIn1[umnIs78] homozygotes). Maintain by picking wild-type GFP+mKate2+. Left flanking Sequence: acgaaaaaagacccagaaaaaatggagaaa; Right flanking sequence: ATATTAATAATAATGAGCTCCGATCGCTCG. eif-2Bbeta crRNA A: aaCGGGGGGTACAAGTTATG; eif-2Bbeta crRNA B: CGGCTTAATGATCACGAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RSL6 |
myo-3(ftw6[myo-3(head)::SL2::mCherry::myo-3(tail)]) V. |
Modifcation of the endogenous myo-3 loci by the insertion of a trans-splicing ICR region and worm-optimized mCherry at region encoding the head-neck junction. Bright red fluorescence is visible as striations in body wall muscles and clusters in single-sarcomere (anal depressor, vuvla, uterine) muscles. Worms are phenotypically wildtype. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL11 |
unc-94(ftw3[GFP::unc-94]) I. |
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Outcrossed parental strain RSL3 with N2. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL48 |
tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. |
Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL49 |
unc-94(ftw3[GFP::unc-94]) I; tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. |
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous tni-3 locus; GFP::NLS coexpressed from the endogenous tni-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL50 |
myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. |
Endogenous myo-3 locus tagged with mCherry using CRISPR/Cas9. nls-GFP coexpressed from the endogenous promoter using trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL51 |
unc-94(ftw3[GFP::unc-94]) I; myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. |
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous myo-3 locus; GFP::NLS coexpressed from the endogenous myo-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL52 |
unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. |
Endogenous locus tagged with GFP using CRISPR/Cas9. NLS-mCherry co-expressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL66 |
pat-3(ftw41[pat-3::GFP::SL2::mCherry]) pat-2(ftw30[pat-2::mCherry::SL2::GFP]) III. |
GFP tag inserted into endogenous pat-3 locus; mCherry coexpressed from the endogenous pat-3 promoter via SL2 trans-splicing. mCherry tag inserted into endogenous pat-2 locus; GFP::NLS coexpressed from the endogenous pat-2 promoter via SL2 trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL83 |
deb-1(ftw60[deb-1::GFP]) IV. |
Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL84 |
myo-2(ftw61[mCherry::myo-2]) X. |
Endogenous locus tagged with mCherry using CRISPR/Cas9. Pharynx muscle is visibly red by dissection fluorescence microscopy. WT pumping and behavior. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL85 |
unc-27(ftw62[unc-27::GFP]) X. |
Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy except for the BWMs near the head. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL86 |
tnc-2(ftw63[tnc-2::GFP]) II. |
Endogenous locus tagged with GFP using CRISPR/Cas9. Pharynx muscle is visibly green by dissection fluorescence microscopy. WT movement and behavior. |
| RSL87 |
ftwEx1. |
ftwEx1 [mlc-2p::GFP::SL2::mCherry::mlc-2]. Pick GFP+ to maintain. Extrachromosomal array expressing GFP and mCherry in muscles. Pharynx and bodywall muscles are visibly bright green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL94 |
unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. |
Severing and tagging of endogenous locus with trans-splicing ICR and GFP using CRISPR/Cas9. Pharynx and body muscles are green fluorescent and visible by dissection fluorescence microscopy. Severing is located upstream of kinase domain. Please contact Ryan Littlefield prior to publishing work using this strain. |
| SHG1675 |
ego-1(ust351[GFP::ego-1]) I. |
GFP inserted into endogenous ego-1 locus using CRISPR/CAS9 engineering. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG2040 |
csr-1(ust371[3xFlag::GFP::csr-1]) IV. |
3xFlag::GFP inserted into endogenous csr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2202 |
ddx-19(ust374[ddx-19::mCherry]) II. |
mCherry inserted into endogenous ddx-19 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2240 |
dcap-1(ust409[dcap-1::GFP::3xFlag]) IV. |
GFP::3xFlag inserted into endogenous dcap-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG3116 |
simr-1(ust618[simr-1::GFP::3xFlag]) I. |
GFP::3xFlag inserted into endogenous simr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG578 |
ustSi64 II. |
ustSi64 [wago-3p::3xFlag::GFP::wago-3::wago-3 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG833 |
glh-1(ust338[3xFlag::GFP::glh-1]) I. |
3xFlag::GFP inserted into endogenous glh-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| CB7550 |
erd-2.1(e997) X. |
Val186Glu. Null allele. Slightly cold-sensitive; dominant suppressor of unc-17(e245). Lethal with erd-2.2(RNAi). Also known as sup-2(e997). Reference: Mathews EA, et al. Genetics. 2021;218(4):iyab065. doi:10.1093/genetics/iyab0. PMID: 33914877. |
| CB5475 |
her-1(e1518) V; sdc-2(y15) X. |
Obligate XO hermaphrodite. Low fertility, segregating many dead XX and nullo-X zygotes. Double mutant combining two null or near-null mutations. Reference: van den Berg MCW, et al. Genetics. 2006 Jun;173(2):677-83. doi: 10.1534/genetics.106.056093. PMID: 16582430. |
| CB7575 |
dhs-29(e3013) X. |
W242StopUAG. Reference null. Surface abnormal, bleach and drug sensitive; resistant to Leucobacter Verde1. |
