| NL2336 |
dpy-20(e1282) IV; pkIs1275. |
pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94. |
| JK1058 |
gld-1(q343)/unc-11(e47) dpy-5(e61) I |
Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579–606. doi: 10.1093/genetics/139.2.579 PMID: 7713419. |
| JK4174 |
K10D2.2(q792) III. |
Superficially wild-type. K10D2.2 is a gld-2 paralog. |
| JK4177 |
pup-3(q793) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q793 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
| JK4220 |
puf-6(q759) II. |
Superficially wild-type. |
| JK4278 |
puf-12(q810) II. |
Superficially wild-type. |
| JK4619 |
tra-1(q106) III/eT1[qIs60](III;V). |
qIs60 [pes-10::GFP + gut specific promoter::GFP + myo-2::GFP]. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP males, and dead eggs (eT1 homozygotes). Pick wild-type GFP+ and check for proper segregation of progeny to maintain. Reference: Schedl T, et al. Genetics. 1989 Dec;123(4):755-69. doi: 10.1093/genetics/123.4.755. PMID: 2612895. |
| JK4930 |
lag-1(q426) IV/nT1[qIs51](IV; V). |
Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP q426 homozygotes (variable phenotypes including sterile, L1 lethal, and small sterile adults with rectal protrusion and occasional bent pharynx). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kadyk LC & Kimble J. Development. 1998 May;125(10):1803-13. doi: 10.1242/dev.125.10.1803. PMID: 9550713. |
| JK5020 |
glp-1(q172) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q172 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Crittenden SL, et al. Development. 1994 Oct;120(10):2901-11. doi: 10.1242/dev.120.10.2901. PMID: 7607080. |
| JK5250 |
pole-1(q831)/hIn1[unc-54(h1040)] I. |
Heterozygotes are fertile WT (non-Unc) and segregate fertile WT (q831/hIn1), fertile Unc (hIn1/hIn1), and sterile non-Uncs (q831/q831). Pick fertile WT and check for correct segregation of progeny to maintain. Reference: Robinson-Thiewes S, et al. G3 (Bethesda). 2022 Mar 4;12(3):jkab439. doi: 10.1093/g3journal/jkab439. PMID: 35100350. |
| JK5305 |
lst-1(q827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q827 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Robinson-Thiewes S, et al. G3 (Bethesda). 2022 Mar 4;12(3):jkab439. doi: 10.1093/g3journal/jkab439. PMID: 35100350. |
| JK5455 |
q833 V/nT1[qIs51](IV; V). |
hets are green pharynx WT and segregate green pharynx WT, fertile non-green pharynx and dead eggs (nT1 homozygotes). q833 is a 472 bp deletion into the intergenic region between mir-61/ mir-250 and F55A11.4. |
| JK5556 |
F17E5.2(q864) X. |
350 bp deletion in F17E5.2 |
| JK5596 |
lst-1(q867) I. |
CRIPSR-engineered mutation of the lst-1M71 longform start codon (ATG to AT, deletion of G). Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205 |
| JK5687 |
pgl-1(q894[pgl-1::SNAP]) IV. |
SNAP tag inserted into endogenous pgl-1 locus between G713 and G714. |
| JK5731 |
cya-1(q903[cya-1::3xMyc]) III. |
Internal 3xMyc tag inserted into endogenous cya-1 locus. |
| JK5736 |
cyb-2.1(q908[3xMyc::cyb-2.1]) IV. |
3xMyc tag inserted at N-terminus of endogenous cyb-2.1 locus. |
| JK5739 |
cyb-2.2(q911[3xMyc::cyb-2.2]) I. |
3xMyc tag inserted at N-terminus of endogenous cyb-2.2 locus. |
| JK5742 |
cyb-3(q914[cyb-3::3xMyc]) V. |
Internal 3xMyc tag inserted into endogenous cyb-3 locus. |
| JK5745 |
cyd-1(q917[cyd-1::3xMyc]) II. |
Internal 3xMyc tag inserted into endogenous cyd-1 locus. |
| JK5748 |
cye-1(q920[3xMyc::cye-1]) I. |
3xMyc tag inserted at N-terminus of endogenous cye-1 locus. |
| JK5751 |
cdk-1(q923[3xMyc::cdk-1]) III. |
3xMyc tag inserted at N-terminus of endogenous cdk-1 locus. |
| JK5758 |
lst-1(q895[lst-1(long)::3xFLAG]) I. |
3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205 |
| JK5796 |
lst-1(q869) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. q869 is a deletion of the entire lst-1 coding sequence as well as 139 bp upstream of M71 start codon and 228 bp downstream of the coding sequence. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205 |
| JLF212 |
par-6(wow31[par-6::ZF1::GFP::3xFLAG]) I; zif-1(gk117) III. |
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of par-6 by providing ZIF-1. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437.
doi: 10.7554/eLife.64437. PMID: 34137371. |
| JLF155 |
zif-1(gk117) III. |
Presumptive null deletion allele of zif-1. ZF1-tagged proteins are not degraded in zif-1(gk117) background. Genotyping primers: ExtFwd: gctcgcaacgactgacaagg // IntRev: GGTACTCGCGGAACACTCACTC // ExtRev: ATTCGTACGGTACTTGCATGAACC |
| JLF145 |
zif-1(gk117) III; air-1(wow14[AIR-1::ZF1::GFP::3xFLAG]) V. |
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of air-1 protein by providing a source of ZIF-1. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857. |
| JLF16 |
ptrn-1(wow4[ptrn-1::GFP]) X. |
GFP tag inserted into endogenous ptrn-1 locus. No overt phenotypes. GFP fluorescence is observed at non-centrosomal microtubule-organizing centers, including the apical surface of intestinal cells. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857. |
| JLF302 |
ebp-2(wow47[ebp-2::GFP::3xFLAG]) II; zif-1(gk117) III. |
GFP and 3xFLAG tags inserted into endogenous ebp-2 locus. No overt phenotypes. GFP fluorescence is observed the tips of growing microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857. |
| JLF14 |
gip-1(wow3[GFP::gip-1]) III |
GFP tag inserted into endogenous gip-1 locus. No overt phenotypes. GFP fluorescence is observed at microtubule-organizing centers. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857. |
| JLF24 |
gip-1(wow5[ZF1::GFP::gip-1]) zif-1(gk117) III. |
ZF1-degron and GFP tags inserted into endogenous gip-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of gip-1 protein by providing a source of ZIF-1. GFP fluorescence is observed at microtubule-organizing centers. Presence of ZF1-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged GIP-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857. |
| JLF173 |
gip-1(wow25[tagRFP-T::3xMyc::gip-1]) zif-1(gk117) III. |
tagRFP-T and 3xMyc tags inserted into endogenous gip-1 locus. No overt phenotypes. RFP fluorescence is observed at microtubule-organizing centers, though generally much dimmer than the GFP allele gip-1(wow3). Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857. |
| JLF348 |
mzt-1(wow51[GFP::3xFLAG::mzt-1]) I; zif-1(gk117) III. |
GFP and 3xFLAG tags inserted into endogenous mzt-1 locus. No overt phenotypes. GFP fluorescence is observed at microtubule-organizing centers. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857. |
| JLF238 |
tpxl-1(wow34[ZF1::GFP::3xFlag::tpxl-1]) I; zif-1(gk117) III. |
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous tpxl-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of tpxl-1 protein by providing a source of ZIF-1. GFP expression is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171. |
| JLF104 |
zyg-9(wow12[ZF1::GFP::SEC::3xFlag::zyg-9]) II; zif-1(gk117) III. |
ZF1-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of zyg-9 protein by providing a source of ZIF-1. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171. |
| JLF425 |
spd-5(wow36[tagRFP-T::spd-5]) spd-2(wow60[spd-2::GFP::3xFlag]) I. |
tagRFP-T tag inserted into endogenous spd-5 locus. GFP and 3xFLAG tags inserted into endogenous spd-2 locus. No overt phenotypes. GFP and RFP fluorescence is observed at centrosomes. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171. |
| JLF361 |
spd-5(wow52[GFP:3xFlag:spd-5]) I. |
GFP and 3xFLAG tags inserted into endogenous spd-5 locus. No overt phenotypes. GFP fluorescence is observed at centrosomes and ciliary base. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171. |
| APL31 |
lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. |
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
| DQM1070 |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. |
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
| DQM1072 |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. |
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
| DQM1051 |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. |
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| DQM1066 |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. |
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| DQM1068 |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. |
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
| ANR165 |
eif-2alpha(rog3) I. |
eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896. |
| OH13513 |
otIs597. |
otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13517 |
otIs601. |
otIs601[ceh-19p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for MC pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH13518 |
otIs602. |
otIs602 [mnm-2p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M3 pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH15089 |
otIs657. |
otIs657 [klp-6p::mCherry + flp-3p::mCherry + klp-6p::NLG1::GFP1-10 + flp-3p::NLG1::GFP11]. IL2-IL1 GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16263 |
otEx7457. |
otEx7457 [sri-9::mCherry + sri-9p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ADL>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH16265 |
otEx7459. |
otEx7459 [srh-18::mCherry + srh-18p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ASH>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
