| MLC1776 |
tbx-43(luc131) III. |
Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 |
| MLC1491 |
lucEx881. |
lucEx881 [C32C4.16::T2A::GFP::H2B(fosmid) + unc-122p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal C32C4.16 fosmid-based reporter. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 |
| ZM7055 |
hpEx2999. |
hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919 |
| IG1839 |
frSi17 II; frIs7 IV; rde-1(ne300) V. |
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454 |
| IG1846 |
frSi21 II; frIs7 IV; rde-1(ne300) V. |
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454 |
| STR35 |
hrtSi1 I; unc-119(ed3) III. |
hrtSi1 [mec-17p::ebp-2::gfp + unc-119(+)] I. hrtSi1 inserted into ttTi4348. GFP marker for microtubules. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR58 |
hrtIs3. |
hrtIs3 [des-2p::myr::GFP + unc-122p::DsRed]. Myristylated GFP marker for PVD. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR71 |
hrtSi5 I. |
hrtSi5 [des-2p::ebp-2::GFP + unc-119(+)] I. hrtSi5 inserted into ttTi4348. EBP-2::GFP expression in PVD and FLP. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR75 |
hrtSi9 I. |
hrtSi9 [ceh-10p::ebp-2::gfp + unc-119(+)] I. hrtSi9 inserted into ttTi4348. EBP-2::GFP expression in CAN. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR66 |
hrtSi4 I. |
hrtSi4 [gcy-36p::ebp-2::gfp + unc-119(+)] I. hrtSi4 inserted into ttTi4348. EBP-2::GFP expression in PQR, URX and AQR. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR161 |
hrtIs5 I. |
hrtIs5 [gcy-5p::ebp-2::gfp + unc-119(+)] I. EBP-2::GFP expression in ASER. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR198 |
hrtIs3; hrtEx52. |
hrtIs3 [des-2p::myr::GFP + unc-122p::DsRed]. hrtEx52 [des-2p::mKate::GS1(high) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. Myristylated GFP marker for PVD. PVD development is quite strongly affected by high levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is more severe than that of the low DeAct-GS1 expressing strain STR199, but weaker than that of the DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR199 |
wdIs51; hrtEx53. |
wdIs51 [F49H12.4::GFP + unc-119(+)]; likely integrated in X. hrtEx53 [des-2p::mKate::GS1(low) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. PVD development is somewhat affected by moderate levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is less severe than that of the high DeAct-GS1 expressing strain STR198 and DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR200 |
hrtIs3; hrtEx54. |
hrtIs3 [des-2p::myr::GFP + unc-122p::DsRed]. hrtEx54 [des-2p::mKate::SpvB + unc-119(+) + lin-48p::tdTomato]. Pick animals with tdTomato expression in the tail to maintain. Myristylated GFP marker for PVD. PVD development is severely affected by low levels of actin-perturbing DeAct-SpvB expression in PVD and FLP. Phenotype is more severe than that of DeAct-GS1 expressing strains STR198 and STR199. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR237 |
unc-44(hrt2) IV. |
Severely Unc. CRISPR-generated deletion removes 111 bp (ACGATAAGAAAACTA...ATGAATCCGCCCAAG). hrt2 allele is specific to the AO13 unc-44 isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111. |
| STR282 |
unc-44(hrt5[unc-44::GFP]) IV. |
CRISPR/Cas9-engineered insertion of GFP tag into the large AO13 splice isoform of the endogenous unc-44 locus at amino acid 6303. Slightly reduced body bends while crawling. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111. |
| STR317 |
hrtSi27 II; unc-119(ed3) III. |
hrtSi27 [des-2p::CRE + unc-119(+)] II. hrtSi27 inserted into ttTi5605. CRE expression in PVD and FLP. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR318 |
unc-119(ed3) III; hrtSi28 IV. |
hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111. |
| STR369 |
hrtSi41 I; unc-119(ed3) III. |
hrtSi41 [des-2p::unc-33L::GFP + unc-119(+)] I. hrtSi41 inserted into ttTi4348. UNC-33L::GFP expression in PVD and FLP. Functional UNC-33::GFP fusion with internal GFP tag inserted at the start of the S isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111. |
| STR473 |
hrtSi57 II; unc-119(ed3) III. |
hrtSi57 [gcy-36p::gcy-35::mKate2 + unc-119(+)] II. hrtSi57 inserted into ttTi5605. mKate2 inserted into gcy-35 after S671 to generate a functional expression construct (Gross et al., 2014). Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. |
| STR485 |
unc-119(hrt13[unc-119::GFP]) III. |
C-terminal GFP tag inserted into endogenous unc-119 locus. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111. |
| STR512 |
hrtSi69 I; unc-119(ed3) III. |
hrtSi69 [des-2p::GFP::unc-33s + unc-119(+)] I. hrtSi69 inserted into ttTi4348. GFP::UNC-33S expression in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111. |
| STR536 |
hrtEx161. |
hrtEx161 [des-2p::PA-GFP::tba-1 + des-2p::mKate2 + unc-119(+) + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. PA-GFP::TBA-1 expression in PVD and FLP; fluorescence can be induced illumination by blue light. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111. |
| MLC903 |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24. |
lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press. |
| MLC1016 |
nDf50 nDf49 II; lucIs20. |
lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. Position of integrated transgene unknown (not on X). mir-35 family mutant expressing a mirtron-version of mir-35. nDf50 nDf49 mutants are partially rescued by expression of mirtron-35 from integrated transgene; mild mir-35-related phenotypes are more severe at elevated temperatures. Strain is derived from injection into parental strain MT14533. Position of integrated transgene unknown (not on X). Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press. |
| MLC1065 |
pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. |
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID*) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867. |
| MLC1245 |
drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. |
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867. |
| MLC1726 |
drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. |
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867. |
| MLC1729 |
drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. |
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867. |
| RG3145 |
pfd-3(ve645[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)] I. |
Homozygous sterile, Pvl. Deletion of 1266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Pvl, sterile adults (ve645 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)]) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cgcgtcaactggaattttctttttccccgg ; Right flanking sequence: ATCAATCTGGCTTGGAGCCAACGTAATGGT. sgRNA #1: aattgagcgtagaaattccg; sgRNA #2: CTCCAAGCCAGATTGATACc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3146 |
T13H5.4(ve646[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1702 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve646 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ACAGAAGTCCTTGTCTTTTCAAATCCTCAT ; Right flanking sequence: CCTCGTGCAAGTTTCTGATGGTTTCTAGAC. sgRNA #1: GGTCACCAGGAAGATGTATG; sgRNA #2: CAGAAACTTGCACGAGGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3147 |
T14B4.3(ve647[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve647 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaccaatgctgatgaaatcaacttccacgg ; Right flanking sequence: GATGGGTAGACAGAAGAAAGATTAGaatta. sgRNA #1: caagagaacttgaaactccg; sgRNA #2: GATCCTGGTTCGACTATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3148 |
+/mT1[umnIs52] II; T20B12.7(ve648[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, slight Dpy. Deletion of 1939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 slight Dpy sterile adults (ve648 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acggttaattgaaaatgctccgcccccgaa ; Right flanking sequence: GTTGGGATGCTTCAAAAAGTCGGACAAAAT. sgRNA #1: cctaacgagagccatggttc; sgRNA #2: GTCCGTCACTTGAAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3149 |
T14B4.8(ve649[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 3703 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaataaggcgatctcagaatcaaaggttc ; Right flanking sequence: ttcgcaagtttcgtgtggtcgttaaaaact. sgRNA #1: tctcagaatcaaaggttcca; sgRNA #2: cacacgaaacttgcgaaatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| PHX1812 |
cfi-1(syb1812[cfi-1(delta_enhancer)::mNG::AID*]) I. |
A4e enhancer was deleted in endogenously-tagged cfi-1(kas16[mNG::AID*::cfi-1]). Expression of cfi-1::mNG::AID* is lost in VNC motor neurons. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031. |
| PHX1856 |
cfi-1(syb1856[cfi-1(mut_COE)::mNG::AID*) I. |
Eight COE motifs in A4e were mutated in endogenously-tagged cfi-1(kas16[mNG::AID*::cfi-1]). Expression of cfi-1::mNG::AID* is down-regulated in late larval stages and adults. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031. |
| KRA345 |
cfi-1(kas16[mNG::AID*::cfi-1]) I. |
mNeonGreen and AID* tags inserted into endogenous cfi-1 locus. Transgene can be degraded in a background expressing TIR1 co-factor supplemented with auxin. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031. |
| RW12257 |
mab-9(st12257[mab-9::TY1::EGFP::3xFLAG]) II. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12259 |
unc-3(st12259[unc-3::TY1::EGFP::3xFLAG]) X. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12261 |
Y53H1A.2(st12261[Y53H1A.2::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12275 |
Y75B8A.6(st12275[Y75B8A.6::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12281 |
ztf-28(st12281[ztf-28::TY1::EGFP::3xFLAG]) V. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12282 |
tbx-37(st12282[tbx-37::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12251 |
snpc-1.2(st12251[snpc-1.2::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12256 |
hlh-32(st12256[hlh-32::TY1::EGFP::3xFLAG]) II. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12263 |
wrm-1(st12263[wrm-1::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12285 |
ZK686.5(st12285[ZK686.5::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12249 |
uaf-2(st12249[uaf-2::TY1::EGFP::3xFLAG]) IV. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12264 |
Y53G8AR.9(st12264[Y53G8AR.9::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12283 |
ztf-29(st12283[ztf-29::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
