Species Information: C. elegans

Name C. elegans

C. elegans strains available at the CGC

Strain Genotype Description
RW12265 Y56A3A.18(st12265[Y56A3A.18::TY1::EGFP::3xFLAG]) III. CRISPR/Cas9 engineered tagged endogenous locus.
RW12267 vab-7(st12267[vab-7::TY1::EGFP::3xFLAG]) III. CRISPR/Cas9 engineered tagged endogenous locus.
RW12271 zfp-3(st12271[zfp-3::TY1::EGFP::3xFLAG]) X. CRISPR/Cas9 engineered tagged endogenous locus.
RW12286 aptf-4(st12286[aptf-4::TY1::EGFP::3xFLAG]) II. CRISPR/Cas9 engineered tagged endogenous locus.
RW12288 B0019.2(st12288[B0019.2::TY1::EGFP::3xFLAG]) I. CRISPR/Cas9 engineered tagged endogenous locus.
RW12292 ceh-45(st12292[ceh-45::TY1::EGFP::3xFLAG]) I. CRISPR/Cas9 engineered tagged endogenous locus.
RW12290 cebp-1(st12290[cebp-1::TY1::EGFP::3xFLAG]) X. CRISPR/Cas9 engineered tagged endogenous locus.
RW12291 Y48G9A.11(st12291[Y48G9A.11::TY1::EGFP::3xFLAG]) III. CRISPR/Cas9 engineered tagged endogenous locus.
RW12293 C17E4.6(st12293[C17E4.6::TY1::EGFP::3xFLAG]) I. CRISPR/Cas9 engineered tagged endogenous locus.
RW12295 Y67H2A.10(st12295[Y67H2A.10::TY1::EGFP::3xFLAG]) IV. CRISPR/Cas9 engineered tagged endogenous locus.
RW12287 ztf-25(st12287[ztf-25::TY1::EGFP::3xFLAG]) V. CRISPR/Cas9 engineered tagged endogenous locus.
RW12296 attf-3(st12296[attf-3::TY1::EGFP::3xFLAG]) III. CRISPR/Cas9 engineered tagged endogenous locus.
TG3320 apn-1(cxTi10435) II. Superficially wild-type. Deletion site verified by PCR. Mos transposon insertion into apn-1; insertion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG3525 fnci-1(tm3081) I. Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG3527 fncm-1(tm3148) I. Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG1792 helq-1(tm2134) III. Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG2520 pole-4(tm4613) II. Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2018 May;28(5):666-675.
TG2228 polq-1(tm2026) III. Superficially wild-type. Deletion site verified by PCR. Reference: Muzzini DM, et al. DNA Repair (Amst.) 2008 Jun 1;7(6):941-50.
TG2978 rev-1(gk924750) II. Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG3880 rev-3(gk919715) III. Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG2519 rip-1(tm2948) III. Superficially wild-type. Deletion site verified by PCR. Reference: Taylor MRG, et al. Cell. 2015 Jul 16;162(2):271-286.
TG4209 smg-1(gk761853) I.
TG2932 tdpo-1(gk889420) IV. Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG1791 ung-1(tm2862) III. Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36.
TG2226 xpc-1(tm3886) IV. Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36.
TG3867 xpg-1(tm1670) I. Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. 2020 bioRxiv, https://doi.org/10.1101/2020.06.04.133306
PS8531 oac-58(sy1376) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-58. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGATCTCATTCACATTCTATTCAATTCTCCCACT right flanking sequence: TGAAGTGGCTTTTAACAGTTTATTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTAAAAGCCACTTCAAGT Method Reference: G3 (Bethesda).
PS8536 oac-51(sy1388) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttaataatttaggcATGGTAGTTTACACCGCT right flanking sequence: CTGTGGAACATTGAAGATCAAAATAAGCAATTTAAAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGTAGTTTACACCGCTCTG Method Reference: G3 (Bethesda).
PS8538 oac-35(sy1390) I. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-35. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTCTAATGTGCATGTTGCTCAAGCGTGCCGAGA right flanking sequence: CCCACCCATTTTTCACGTTGTTATGCACATTTTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGAAAAATGGGTGGGTCT Method Reference: G3 (Bethesda).
PS8540 dod-17(sy1392) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-17. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTAATTGATGGTACGCCTGTATATTGGCCAGCT right flanking sequence: GCTTGGAACGAGACTCAGCCTGCTCCTCAGCTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAGTCTCGTTCCAAGCAGC Method Reference: G3 (Bethesda).
PS8542 acs-10(sy1394) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of acs-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTCTGGACTCATGTCGTATCCATGCAGCCGCCA right flanking sequence: ATAAGGACGCCATAGTTTTTgtgagtacggatttatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTATGGCGTCCTTATTGG Method Reference: G3 (Bethesda).
PS8544 clec-87(sy1396) I. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-87. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTTTTGCCTTCTCGTTGCTTTCATCCTTCCTGGG right flanking sequence: CTATTCCTCGTTCATGCAGCTCCGACTTCTTCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCATGAACGAGGAATAGCCC Method Reference: G3 (Bethesda).
PS8578 clec-88(sy1409) II. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTGGTATGTGCAGTTACTAACGATATTGAAGACGC right flanking sequence: TAGTGGAGAGACACCTGGAATTGTTTCTCAAATTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGATATTGAAGACGCTAG Method Reference: G3 (Bethesda).
PS8582 oac-41(sy1413) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATTTTAATATTAGTACACGTTTTTCTACCGGAT right flanking sequence: TTCCTGTGGCAAAATAATAATAGATACTCTTTCGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTATTTTGCCACAGGAAATC Method Reference: G3 (Bethesda).
PS8584 clec-91(sy1415) I. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-91. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGACCTACATCCTTATCATCGTCCCACTGATCAT right flanking sequence: CATTGGAGGCGGTGTCGTCGCTGACAACACAAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCGTCCCACTGATCATCAT Method Reference: G3 (Bethesda).
PS8630 oac-44(sy1431) I. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTCGGATTCCACTTCTACCCAAACCAGTTTCC right flanking sequence: CAATGGATACCTCGGAGTGGATCAgttaggtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCCAAACCAGTTTCCCAA Method Reference: G3 (Bethesda).
PS8632 oac-42(sy1433) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-42. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTGACTTACAAGGAATTCGGGGTCTCGCCATTG right flanking sequence: CTGCAGTGCTTCTTTATCACTTTTATCCAAAACAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGAAGCACTGCAGCAA Method Reference: G3 (Bethesda).
PS8634 col-135(sy1435) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCT right flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGG Method Reference: G3 (Bethesda).
PS8636 ins-10(sy1437) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda).
PS8674 nlp-6(sy1449) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCGACTCGCCTTCGTTCTTCTCGTCTCGGCGTGCG right flanking sequence: TCATGGCAATGGCTGCTCCAAAACAAATGGTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTCGTCTCGGCGTGCGTCA Method Reference: G3 (Bethesda).
PS8676 nlp-9(sy1451) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-9. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gaaaaaaagagagATGGATCGATTCGCCACCAGAT right flanking sequence: TTATCGCCCTTCTTCTGGTTCTTTTACAAATTGgtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGAAGAAGGGCGATAAATC Method Reference: G3 (Bethesda).
PS8678 nlp-13(sy1453) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATCTCTTCAGATCTTCTGCATCATGTCCGCCA right flanking sequence: TCGCAATGGCATACAGTCAAGgtttgtgttgtgtc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTGTATGCCATTGCGATGG Method Reference: G3 (Bethesda).
PS8680 nlp-16(sy1455) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-16. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTTTCCCCATTGGAAAAGACAATGAATCCGACG right flanking sequence: AGTCCGAAGTTGAAGTGGATACCACAACTGAAGCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTTCAACTTCGGACTCGT Method Reference: G3 (Bethesda).
PS8682 nlp-19(sy1457) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ctctactgttgtatattcttcttcacaATGCTCTT right flanking sequence: ACGCGGTGTATGCCTTGCTCTTCTCATTCTAGTCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTTCACAATGCTCTTACG Method Reference: G3 (Bethesda).
PS8687 nlp-32(sy1459) III. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTACTTGTATTCTGTCTTATCGCATTGACCGCCT right flanking sequence: TGCCGGTTTTCTCTTTTCCAAATGGGCTAACTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGAGAAAACCGGCAAGG Method Reference: G3 (Bethesda).
PS8689 nlp-33(sy1461) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-33. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTCTCTTTGCCATATTGGCTATCGTTGATGCCCA right flanking sequence: GTGGGGATgtaagttttcaataacttgtttctg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTATCGTTGATGCCCAGTG Method Reference: G3 (Bethesda).
PS8691 nlp-43(sy1463) III. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gctcggaagtATGTCGTTGGCTCAATCTACCTTCT right flanking sequence: ACCTTCTATTTGTTGCATTTTTGGCAGTTGTGATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACAAATAGAAGGTAGA Method Reference: G3 (Bethesda).
PS8693 nlp-73(sy1465) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-73. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGCTCATCGCGACCACTGTGCTCATCGCCGAGT right flanking sequence: CTCGTGTATTCTATAACCGATTCGACGGCGGGCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATAGAATACACGAGACT Method Reference: G3 (Bethesda).
PS8697 lgc-18(sy1469) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-18. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtttttattcaaaatgttaattcttcattttgcagTTCCG right flanking sequence: GAATGGAACAATTTCTTGGAGAATCAAGTTAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCATTTTGCAGTTCCGGAA Method Reference: G3 (Bethesda).
PS8702 lgc-19(sy1472) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCGATTCTTTTTTCTTTGATCCAGAGTTATAC right flanking sequence: Ggtaggctattttggctttcaggctcaaaaaaggtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGATCCAGAGTTATACGGT Method Reference: G3 (Bethesda).