Laboratory Information
| Name | DV View on WormBase |
|---|---|
| Allele designation | re |
| Head | David J Reiner |
| Institution | Texas A&M Health Science Center, Houston, TX |
| Address | Institute of Biosciences and Technology Texas A&M Health Science Center 2121 West Holcombe Blvd, Rm 916 Houston 77030 United States |
| Website | https://ibt.tamhsc.edu/faculty/reiner-bio.html |
| Gene classes | rgl rsu hgap kbrl |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| DRb546 | E. coli | Escherichia coli | Bacteria. Ampicillin & tetracycline resistant. E. coli HT115(DE3) strain carrying pREW2 plasmid expressing dsRNA luciferase. Can be used as a negative control for RNAi experiments in lieu of empty vector. Fragment of luciferase coding sequence was subcloned into L4440 to produce pREW2. Sequence inserted into pPD129.36(L4440) HindIII - XhoI sites: "cataaagaaaggcccggcgccattctatcctctagaggatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtgaacatcacgtacgcggaatacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgc" Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681.e5. doi: 10.1016/j.celrep.2018.08.011. PMID: 30184501. |
| DV2208 | unc-97(su110) X. | C. elegans | Made by outcrossing HE110 four times. su110 is moderately Smg suppressible: HE110 animals are significantly less Unc than DV2208, and HE110 animal are also pVul, which is characteristic of Smg mutations. |
| DV2275 | daf-2(e1370) dpy-17(e164) III. | C. elegans | |
| DV2689 | sec-5(pk2357)/mIn1 [dpy-10(e128) mIs14] II. | C. elegans | Heterozygotes segregate wild-type GFP+ heterozygotes, GFP+ Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Pick GFP+ wild-type to maintain. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.] |
| DV3089 | rheb-1(re64[mKate2::3xFlag::rheb-1]) III. | C. elegans | mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. Reference: Duong T, et al. Development. 2020 Mar 2;147(5):dev181727. doi: 10.1242/dev.181727. PMID: 32041790. |
| DV3208 | daf-15(re147[daf-15::mNG::2xHA]) IV. | C. elegans | mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression. |
| DV3285 | his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. | C. elegans | Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development. |
| DV3312 | rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. | C. elegans | Ubiquitous expression with cytosolic localization. Derived in an N2 background. Detection with triplex primers: HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’ HS126 5’-TTGTCCTCCTCTCCCTTGG-3’ HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3' Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501 |
| DV3313 | rap-1(re180) IV. | C. elegans | Gain-of-function allele (G12V). Low penetrance of 3˚ to 1˚ fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933. |
| DV3327 | pmk-1(re170[pmk-1::mNG::3xFlag]) IV. | C. elegans | mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501 |
| DV3402 | ral-1(re218[mKate2::3xFlag::ral-1]) III. | C. elegans | Ubiquitous expression and localization to plasma membranes. Derived in an N2 background. TD185 5’ -GCCGGAAGAGTGATGAACCC- 3’ TD186 5’ -TAATGAGCTCGGAGACCATGGC- 3’ TD187 5’ -CGCACCTCATCATACATGAACTGC- 3’ Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501 |
| DV3462 | rheb-1(re242)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. | C. elegans | Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP re242 homozygotes (arrested at L3). nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. |
| DV3525 | daf-15(re257[daf-15::mNG::AID*]) IV. | C. elegans | mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID* at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin. |
| DV3624 | lin-31(re272[GFP::3xFlag::lin-31]) II. | C. elegans | GFP::3xFlag tags inserted at N-terminus of endogenous lin-31 locus. Nuclear GFP expression in Pn.ps and unidentified head and tail nuclei. guide RNA+PAM: CCCTGAAAAATGCCAAGACC CGG. Flanking insert sequences: 5'+spacer: aagcaaaactctatacatattccctgaaaaATGCCAAGA. 3': atgccaagacccggaaaagactcgtacgat. Qi Zhang and David Reiner, unpublished. |
| DV3651 | his-72(erb77[his-72::linker::mTurquoise2]) III; yap-1(re269[yap-1::mNG::2xFLAG]) X. | C. elegans | mTurqoise2 tag with linker sequence inserted into endogenous his-72 locus. mNeonGreen::2xFLAG tag inserted into endogenous yap-1 locus. Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells, deficiency of wts-1 (Warts/LATS) causes translocation into nuclei of all cell types observed. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717. |
| DV3670 | rheb-1(re64 re285[AID*::mKate2::3xFlag::rheb-1]) III. | C. elegans | AID* tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous mKate2 expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. universal mKate2 site crRNA: catgttttctttaatgagct / insertion site in mKate2:gaagATGCCA....GGAGCATCGGGAGCCTCAGGAGCATCGATGGTCTCCGAGC^TCATTAAAGA. Reference: Fakieh R, et al. MicroPubl Biol. 2022 Aug 9:2022:10.17912/micropub.biology.000622. doi: 10.17912/micropub.biology.000622. PMID: 36035777. |
| DV3709 | ieSi57 II; unc-119(ed3) III; mig-15(re264[AID*::mNeonGreen::2xHA::mig-15]) X. | C. elegans | ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::mNeonGreen::2xHA tag inserted into endogenous mig-15 locus. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of MIG-15 in somatic tissues. Auxin treatment causes locomotion defects, pVul, and weak Muv. Ubiquitous red fluorescence in cytoplasm. Ubiquitous mNeonGreen expression, some cytoplasmic, some localized to punctae and junctions. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Fakieh RA & Reiner DJ. Proc Natl Acad Sci USA. 2025 Jan 7;122(1):e2414321121. doi: 10.1073/pnas.2414321121. PMID: 39739816. |
| DV3765 | scd-1(re305[scd-1::mKate2::2xHA]) X. | C. elegans | mKate GLO (germline optimized) tag inserted at C-terminus of endogenous SCD-1. Red fluorescence in all nuclei. Cas9 guide + PAM: GACTTGGAAGAAGACGGTGG+AGG. Reference: Ailion M, et al. In preparation. |
| DV3799 | reSi1 I. | C. elegans | reSi1 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei. |
| DV3800 | reSi2 II. | C. elegans | reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei. |
| DV3801 | reSi3 I. | C. elegans | reSi3 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei. |
| DV3803 | reSi5 I. | C. elegans | reSi5 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei. |
| DV3805 | reSi7 I. | C. elegans | reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp). |
| DV3825 | reSi11 II. | C. elegans | reSi11 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei. |
| DV3826 | reSi12 II. | C. elegans | reSi12 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei. |
| DV4012 | rap-2(re346[mKate2::3xFLAG::rap-2]) V. | C. elegans | mKate2::3xFLAG tag inserted into endogenous rap-2 locus. Ubiquitous red expression, plasma membrane with some cytosolic localization. Reference: Fakieh RA & Reiner DJ. Proc Natl Acad Sci USA. 2025 Jan 7;122(1):e2414321121. doi: 10.1073/pnas.2414321121. PMID: 39739816. |
| DV4186 | his-72(erb77[his-72::linker::mTurquoise2]) III; yap-1(re269[yap-1::mNG::2xFLAG]) reDf4 X. | C. elegans | Mild uncharacterized Unc. reDf4 is a deletion of the tandemly duplicated cst-1 and cst-2 loci as well as intervening ncRNAs. Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717. |
| DV4290 | wts-1(re419[mTurquoise2::2xMYC::AID*::wts-1]) I; ieSi57 II; unc-119(ed3) III. | C. elegans | ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. mTurquoise2::2xMYC::AID* tag inserted into endogenous wts-1 locus. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of WTS-1 in somatic tissues. Auxin treatment causes growth delay. Auxin treatment coupled with wts-1(RNAi) causes L2 growth arrest. Ubiquitous red fluorescence. Blue WTS-1 fluorescence never detected. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. |
| DV4326 | bar-1(ga80) X. | C. elegans | Variably penetrant Unc, Vul, pVul, Egl, vulval rupture, and slow growth. Parental strain EW15 was outcrossed to separate bar-1(ga80) from a described background PRY-1(N354K) mutation. The phenotypes of the outcrossed strain are much more severe than those of the progenitor strain EW15. |
| FZ282 | sec-5(pk2357)/dpy-10(e128) II. | C. elegans | Heterozygotes segregate wild-type heterozygotes, Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.] |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| re1 | Allele | substitution | nonsense |