Search Strains

More Fields
Strain Species Genotype Add
JDW182 C. elegans bmdSi15 lmn-1(wrd39[lmn-1::1xGFP11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.
OTL231 C. elegans jpnIs20 I; rab-3(jpn61[7xGFP11::rab-3]) II. Show Description
jpnIs20 [itr-1p::GFP1-10 + odr-1p::DsRed] I. 7xGFP tag was inserted into the N-terminal of the endogenous rab-3 locus. Expression in DA9 synapses can be observed. Generated in N2 background.
UJ1300 C. elegans unc-9(miz81[unc-9::7xGFP11]) X; juIs463. Show Description
juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. 7xGFP11 tag inserted into endogenous unc-9 locus. unc-9(miz81) is Unc, possibly due to increased channel activity. Reference: Hendi A, et al. Elife. 2022 Nov 15;11:e80555. doi: 10.7554/eLife.80555. PMID: 36378164.
UJ1940 C. elegans syd-2(miz231[7xGFP11::syd-2]) X. Show Description
7xGFP11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ2587 C. elegans elks-1(miz365[elks-1::7xGFP11]) IV. Show Description
7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ2719 C. elegans unc-10(miz404[unc-10::7xGFP11]) X. Show Description
7xGFP11 tag inserted into endogenous unc-10 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ2820 C. elegans cla-1(miz321[cla-1::7xGFP11]) IV. Show Description
7xGFP11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ3045 C. elegans rimb-1(miz458[7xGFP11::rimb-1]) III. Show Description
7xGFP11 tag inserted into 5' end of endogenous rimb-1 locus using CRISPR/Cas9. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.