Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3155 C. elegans vps-2(ve655[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 850 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve655 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CTCTTCTAAGCTGATCAAGACGGGCCTGAA ; Right flanking sequence: AGGAAATCCATctgaaaagtggaatatttc. sgRNA #1: TGATGTTGACGATGATCTTC; sgRNA #2: tttcagATGGATTTCCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3301 C. elegans vps-25(ve801[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [unc-54(h1040)] I. Show Description
Late larval arrest. Deletion of 1316 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear arrested L4 larvae (ve801 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CAAATAAATTTAACGCCTTCATTATCTCCA ; Right flanking sequence: CGGCctgaaaaatgcgtaattccctgaaaa. sgRNA #1: GCTCAATTGATGAATATCGG; sgRNA #2: TGACACCGTCGGTTGAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC1780 C. elegans vps-28(ok2278)/hIn1 [unc-101(sy241)] I. Show Description
Y87G2A.10. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAGACGTTGTGTCTTCCCG. External right primer: CTACAAACCGAGCTGAGCCT. Internal left primer: CCTCACAATTTTGAAACTGCTC. Internal right primer: AATTTCGAGTTTTCGCTTGAA. Internal WT amplicon: 3080 bp. Deletion size: approximately 1600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4709 C. elegans vps-24(gk5778[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1298 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CACGTTGTCATCGTTTCGCAATATTTGTTG. Right flanking sequence: CATCTTACTGTAATATACGGAACCCTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7090 C. elegans +/mT1 [umnIs52] II; vps-22(hd7082 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7082 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7082 and CGC66. hd7082 is a 525 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.