Search Strains

More Fields
Strain Species Genotype Add
BCN9071 C. elegans vit-2(crg9070[vit-2::gfp]) X. Show Description
GFP knocked into C terminal of vit-2 gene by CRISPR/Cas9 using self-excising drug selection cassette method of Dickinson et al. (2015, Genetics). Strain is derived from BCN9070, which was outcrossed to remove a linked background mutation on LG X causing transgenic males to mate poorly. Reference: Perez MF, et al. Nature. 2017 Dec 7;552(7683):106-109.
AY142 C. elegans vit-2(ac3) X. Show Description
vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
RB2365 C. elegans vit-2(ok3211) X. Show Description
C42D8.2 Homozygous. Outer Left Sequence: atggagcacgctcttgctat. Outer Right Sequence: tgggatctttccagagatgg. Inner Left Sequence: tcacatggaaaacgaggaca. Inner Right Sequence: gctcttggttgagaagacgg. Inner Primer PCR Length: 1222. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RT130 C. elegans pwIs23. Show Description
pwIs23 [vit-2::GFP].
AY132 C. elegans zcIs4 V; vit-2(ac3) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
DH1033 C. elegans sqt-1(sc103) II; bIs1 X. Show Description
bIs1[vit-2::GFP + rol-6(su1006)].
AY156 C. elegans acIs156. Show Description
acIs156 [vit-2p::vit-2(G839R)::GFP + myo-2p::mCherry]. In contrast to VIT-2::GFP, VIT-2(G839R)::GFP remains in the intestine and is not transported to embryos. mCherry expression in pharynx. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
BR8724 C. elegans pqm-1(ok485) II; pwIs23. Show Description
pwIs23 [vit-2::GFP]. Reference: Heimbucher T, et al. Nat Commun. 2020 Oct 2;11(1):4627. doi: 10.1038/s41467-020-18369-w. PMID: 33009389.
MQD2774 C. elegans vit-6(hq486[vit-6::mCherry]) IV; vit-2(crg9070[vit-2::gfp]) X. Show Description
mCherry knocked into C terminal of vit-6 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.
MQD2775 C. elegans vit-3(hq485[vit-3::mCherry]) vit-2(crg9070[vit-2::gfp]) X. Show Description
mCherry knocked into C terminal of vit-3 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.
MQD2798 C. elegans vit-2(crg9070[vit-2::gfp]) vit-1(hq503[vit-1::mCherry]) X. Show Description
mCherry knocked into C terminal of vit-1 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.
MQD2884 C. elegans vit-2(ok3211) vit-1(hq532) X. Show Description
hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https://doi.org/10.1101/2022.06.27.497668
RT362 C. elegans rme-4(b1001) X; pwIs23. Show Description
pwIs32 [vit-2::GFP]. Yolk endocytosis defective.
RT99 C. elegans rme-4(b1001); bIs1. Show Description
bIs1 [vit-2::GFP + rol-6(su1006)]. Rollers. Yolk endocytosis defective. Reference: Sato M, et al. EMBO J. 2008 Apr 23;27(8):1183-96.
AWR61 C. elegans keaSi11 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi11 [vit-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]