| FX30138 |
C. elegans |
tmC6 [dpy-2(tmIs1208)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| RG3332 |
C. elegans |
skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3505 |
C. elegans |
tsr-1(ve1005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Sterile. Deletion of 7616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry sterile adults (ve1005 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Note: tsr-1 is near ZK1240.1, the gene marking the breakpoint of the tmC6 balancer. Left flanking Sequence: aaatTTAGATGAACAGCTTGGCGAGATCAC; Right flanking sequence: tagtgagctctagttttcggtgtctaggct. tsr-1 crRNA A: GAGTATGGTTGAAGACGGCG; tsr-1 crRNA B: gctcaattttgaagtctcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7210 |
C. elegans |
pigw-1(hd7204[LoxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with tmC6. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and Dpy mCherry+ homozygotes. Derived from parental strains VH204 and FX30138. hd7204 is a deletion of 3569 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGAACACCAGGCGACTGTATTGAACATTTG; Right flanking sequence: GAATGTCCGAATTTCTCGGTTTTTGCGTAT. sgRNA #1: GATTGATAGGCAGACTCCGG; sgRNA #2: GATGATGGATGTCGGAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|