Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
VC3824 C. elegans sel-11(gk3792[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2037 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTGGCTCGTGTGTGGCGACTGCGGCCA; Right flanking sequence: CGGACCGTCAACAGATCAAGTCACTTCGGA. See WormBase Variation gk3792 for details.
GS776 C. elegans unc-32(e189) lin-12(n676n930) III; unc-42(e270) sel-11(ar39) V. Show Description
Unc. At 25C ar39 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar39 recessively suppresses vulval lineage defects and proximal mitosis. Do not distribute this strain; other labs should request it from the CGC.
SLP266 C. elegans sel-11(rem5) V. Show Description
Prolonged lethargus sleep duration. rem5 is an early stop mutation, likely null. Reference: Kawano T., et al. Cell Rep. 2023 Mar 28;42(3):112267. PMID: 36924492.