| VC851 |
C. elegans |
ptr-2(ok1338)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
C32E8.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon-2 males and ok1338 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| KR917 |
C. elegans |
ptr-2(h345) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in egg/early larval development.
|
|
| RB2393 |
C. elegans |
ptr-20(ok3263) II. Show Description
Y53F4B.28 Homozygous. Outer Left Sequence: acctaagccaagccctaagc. Outer Right Sequence: gacctgagaaaatgcaaggc. Inner Left Sequence: gcctaagcctgtgcctaaaa. Inner Right Sequence: tttggacagctttaattccga. Inner Primer PCR Length: 1185. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3219 |
C. elegans |
ptr-23(ok3663) I. Show Description
ZK270.1. Dpy or Dpyish. External left primer: CAACCAGATGACGCAGCTAA. External right primer: TGATTCCATTTCACGGACAA. Internal left primer: CCGGTCTCCAGGATAACAAA. Internal right primer: GTAGCCATGGAATACACGGG. Internal WT amplicon: 1140 bp. Deletion size: 899 bp. Deletion left flank: GGATAACAAATGTAAAGTCAGTCAAAATGA. Deletion right flank: ATATACACATTTGATGACGACACCGCTGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4139 |
C. elegans |
ptr-22(gk5222[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 4054 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAAAAACGGCGGAAAAAATGGAGATGAGG ; Right flanking sequence: ATACTGGAGTAGTCGAAAGTACACCATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4143 |
C. elegans |
ptr-21(gk5226[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3539 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCATCGGATCAAGTATTTGGAAGAAGCAC ; Right flanking sequence: CTCAGTTGGCCTAGCGACCGCTTCGATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4148 |
C. elegans |
ptr-20(gk5231[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3301 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGAAGCACTCGGTGAAGTTTCGCAGGCTCA. Right flanking sequence: TCGTACTAATGTCCCTTCTAGTGTTGGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4633 |
C. elegans |
ptr-24(gk5702[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 10478 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGTCTGTTTGTTTTTTTACTTATCCACAG. Right flanking sequence: TTCGGTCCTCATAAAACGTAAATTTTATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|