| CB4123 |
C. elegans |
lon-3(e2175) V. Show Description
Long, especially obvious in adults. Males mate well.
|
|
| MH2003 |
C. elegans |
lon-3(ct417) V. Show Description
Long.
|
|
| MH2051 |
C. elegans |
kuIs55. Show Description
kuIs55 [lon-3::GFP + unc-119(+)]. Rollers. The kuIs55 lon-3::GFP transgene does not rescue the Lon phenotype of lon-3 mutants, but instead causes an adult Rol (Roller) phenotype both in lon-3 mutants and in wild-type backgrounds. Reference: Suzuki Y, et al. 2002. Genetics 162: 1631–1639.
|
|
| RB1671 |
C. elegans |
lon-3(ok2076) V. Show Description
ZK836.1. Homozygous. Outer Left Sequence: TAACACCGGAAAATGCACAA. Outer Right Sequence: TATGGACCTCAATGGGTGGT. Inner Left Sequence: AATGCTTTTCGTCGATACGG. Inner Right Sequence: ATGTGTTCTGCTTCTGCGTG. Inner Primer PCR Length: 2770 bp. Deletion Size: 1472 bp. Deletion left flank: GGTCCACGTGGTCCTTCCTCTCTGAAATTT. Deletion right flank: AACGAGTTACTGTAACTCGTGTTGATTTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| GS878 |
C. elegans |
unc-32(e189) lin-12(n676n930) III; lon-3(e2175) sel-10(ar41) V. Show Description
Long. Unc. At 15C ar41 suppresses the 2 AC (anchor cell) phenotype of n676n930. (Strain GS878 does not contain sel(arX) and therefore does not suppress the Egl phenotype at 25C.) See also WBPaper00002966. Do not distribute this strain; other labs should request it from the CGC.
|
|
| CB7517 |
C. elegans |
ptr-15(cr52) lon-3(e2175) V; eEx730. Show Description
eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lon. Non-GFP animals will mostly be dead eggs and dead hatchlings, but can segregate rare GFP-negative viable ptr-15 lon-3 homozygotes (which are fertile but grow very poorly). Reference: Kuwabara et al. (in prep.)
|
|
| FX19173 |
C. elegans |
lig-4(tm750) III; tmIn19 V. Show Description
Break points: In(unc-23 lon-3) V. Covered region (Mb) 3.3 (8.9..12.2) Lon Unc. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30133 |
C. elegans |
tmC3 V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30134 |
C. elegans |
tmC3 [egl-9(tmIs1228)] V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30135 |
C. elegans |
tmC3 [egl-9(tmIs1230)] V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::mCherry. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30152 |
C. elegans |
tmC12 [egl-9(tmIs1194)] V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30153 |
C. elegans |
tmC12 [egl-9(tmIs1197)] V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::mCherry. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30154 |
C. elegans |
tmC12 V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| UDN100049 |
C. elegans |
let-413(udn27)/tmC3[egl-9(tmIs1230)] V. Show Description
let-413 [L248P]. Variant edit. Homozygous lethal or sterile deletion balanced by tmC3. Heterozygotes are wild-type mCherry+ and segregate mCherry+ heterozygotes, udn27 homozygotes (arrest stage unknown), and mCherry+ tmC3 homozygotes (Unc-23 Lon-3). Pick viable fertile mCherry+ animals to maintain. ApoI-HF restriction site created by synonymous changes for ease of genotyping.
|
|
| VC4382 |
C. elegans |
ptr-1(gk5276[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC3[egl-9(tmIs1230)] V. Show Description
Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|