| BK530 |
C. elegans |
ifc-2(qp110) X. Show Description
Large cysts in excretory canal, sometimes visible with dissecting microscope. qp110 deletion removes part of promoter and first 2 bases of start codon of ifc-2. Deletion of bases 650114 ttttctagggtcctcatcacaaAT 650091 of Chr X (Wormbase WS297 release). Reference: Al-Hashimi H, et al. Genetics. 2018 Oct;210(2):637-652. doi: 10.1534/genetics.118.301078. PMID: 29945901.
|
|
| MJ563 |
C. elegans |
tpa-1(k530) IV. Show Description
Animals grow to be adults with smaller than normal body size and produce a reduced number of progeny on TPA-containing medium. No other apparent phenotypes were so far observed on NGM. Tc1 was originally inserted into a 2.4 kb HindIII genomic fragment. The 1.8 kb portion adjacent to the 3' end of the inserted Tc1 was replaced by an unidentified 1.0 kb fragment probably due to rearrangement during backcrossing.
|
|
| RB765 |
C. elegans |
lite-1(ok530) X. Show Description
C14F11.3. Homozygous. Outer Left Sequence: CAAAGTCGCGAACAATTGAA. Outer Right Sequence: CGCTTGAGTGGGCTTTACTC. Inner Left Sequence: TGGCAAATTGCTTTGGGTAT. Inner Right Sequence: CAAGAAGACCATGATCGCAA. Inner primer WT PCR product: 3355. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1158 |
C. elegans |
T07F8.4(gk530)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T07F8.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk530 homozygotes (sterile adult, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCACTTGGCTGATTCGTCTG. External right primer: TGTGCAAATGGATCAGGTGT. Internal left primer: CCTTCAACCGTTGCTTCATT. Internal right primer: ACAGAACGATCGGGAAGTTG. Internal WT amplicon: 1857 bp. Deletion size: 974 bp. Deletion left flank: GGTTCTGCAGCAGCCGAACTTGATTCCCCT. Deletion right flank: TTACTGAGCAAACGCTTTAGTGTTAGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| JK5305 |
C. elegans |
lst-1(q827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q827 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Robinson-Thiewes S, et al. G3 (Bethesda). 2022 Mar 4;12(3):jkab439. doi: 10.1093/g3journal/jkab439. PMID: 35100350.
|
|
| VC4214 |
C. elegans |
D2005.4(gk5300) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5300 mutation is G->A, flanking sequences AATCTTGATTTTAAATGCGAACGATTTTCA and GGCGAAGACTACAATGTGCAGCAGGCAAAA.
|
|
| VC4217 |
C. elegans |
oac-56(gk5303[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCATGTCATCTGGCCTAGTTACAGCGTAGT ; Right flanking sequence: ATTGGATGTCTTCTCGCATTGTGGTAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4220 |
C. elegans |
frpr-16(gk5305[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1685 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATAATTGTTTGTTTGACAAAAACCGGGA ; Right flanking sequence: GGTGGAAACGGAAATGAAAGAAAAAACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4222 |
C. elegans |
glc-1(gk5307[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2233 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CATCTTTAATTTTGGGAATACAAGCCCAAC; Right flanking sequence: TAGCAAAAGTATTCCGAACATTTTGGCGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4223 |
C. elegans |
Y57G11B.2(gk5309[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2052 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTTAATCTGAAAAGCAACACTAGAAACCA; Right flanking sequence: GGGTTCAAATCAATTATTTCTGTAATTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|