Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3451 C. elegans gst-1(ve951[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTCAACTTCGTTCAATATGACCCTCAAG ; Right flanking sequence: TGGAAATGGAAAACAATAAGCTAATTCAAT. gst-1 sgRNA A: CTCACGTACTTCGACATCCA; gst-1 sgRNA B: GCTATCAACCCACCAGTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4899 C. elegans gst-13(gk5967[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 906 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CTATTGATTGTTTTATTGTATTAACAACCA. Right flanking sequence: CGGTTGATAGAAATTTTAAAATAATCGGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7047 C. elegans gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.