Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1293 C. elegans F45C12.3(gk583) II. Show Description
F45C12.3. Superficially wild type. External left primer: GCTCATTGTGCACCTCCTTT. External right primer: CTGCAACAACGACTGTCCAT. Internal left primer: AGAGTGTGGAGAGCTCGGAA. Internal right primer: CCTACACCCACAGGCTGTTT. Internal WT amplicon: 1871 bp. Deletion size: 722 bp. Deletion left flank: GAGCCATATGCCGTCCGTAAAAGCGAAGAG. Deletion right flank: ACCCAGTGAGCTTGAGCTTGAAAAACTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG5028 C. elegans ZC434.4(gk5836[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5836 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4768 and CGC92. gk5836 is a 1235 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCATTCTTGATATGCAATGTTTTTTAAA; Right flanking sequence: TGGGCTAAGAGTTCCGATGCACCCTCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4762 C. elegans pepm-1(gk5830[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1184 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAATAAGCCGATCTGCAAAATTACAGCCT. Right flanking sequence: TGCAAAGTTCTGGCTGACTGTGATAACTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4763 C. elegans ltd-1(gk5831[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 4104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGATAACTAAGGACAATTGGAATACCCT. Right flanking sequence: GTCATAAACATGGCGAGAATAGATGTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4764 C. elegans VB0395L.1(gk5832[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 4025 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTGAAAAAGTACGACGTCTAGGTTGACCT. Right flanking sequence: AGGGAAAATGATGATTTCTTATCTATCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4765 C. elegans ltah-1.2(gk5833[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 3939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTAACGAAAATCAGGGGAAAAGGGGAAAGA. Right flanking sequence: GCTTATCGCTTCTCGAAAAATTCTCGAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4766 C. elegans K02E7.10(gk5834[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1091 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTAGCCAACTTCATATATCCGTGCTCTCCC. Right flanking sequence: AGGTTTTTGGCTGGTATGGCATGAAGTGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4767 C. elegans best-26(gk5835[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4496 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTGTCAACTTTAAAGGCGCATACCTTAGAA. Right flanking sequence: CGGAGATTCAATAGCAGTGCAAAAAAGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4768 C. elegans ZC434.4(gk5836[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5028 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1235 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTCCATTCTTGATATGCAATGTTTTTTAAA. Right flanking sequence: TGGGCTAAGAGTTCCGATGCACCCTCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4769 C. elegans F09D12.2(gk5837[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGTAGGTATGAAACTTCAAGCAGAATTAG. Right flanking sequence: TGGAACATTTTTAGTTCAAAAAAACGTAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4770 C. elegans Y48G8AL.7(gk5838[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 5065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACAGATGCTGCCAGTGAAAAAAGCCGTG. Right flanking sequence: CGGAAAAGATGAAAAAGTTCCGAAATCTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4771 C. elegans T06A4.1(gk5839[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4720 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CATAGGCATTTTTCAACTTTTTCTAGGCCA. Right flanking sequence: CTATTTGGATATTTGCCAGCGACCTATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.