Search Strains

More Fields
Strain Species Genotype Add
VC1139 C. elegans mom-4(gk563) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F52F12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk563 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGAACTTGGCTGTTGGA. External right primer: CGCAGATGTATGGTTTGGTG. Internal left primer: TTGAAACATCCATGAAGCCA. Internal right primer: CACTGATGAACAGCAAACGG. Internal WT amplicon: 2042 bp. Deletion size: 632 bp. Deletion left flank: AAGAATATTTGATTGCTGCTGGCCTGAAAA. Deletion right flank: AGACCAACGGGACACAGACAGATTTCCGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG5024 C. elegans cox-7C(gk5632[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5632 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4561 and CGC92. gk5632 is a 1065 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATCAAAGTCAGAGTTTTATGGCTCACCG; Right flanking sequence: GGGGCTTGTAAGATGAGAAGCACCCGTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4559 C. elegans mib-1(gk5630[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 3828 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGCAGATGTGACATTGCTTCTTCAGTTT. Right flanking sequence: TGACCGAGAAGCTGAAAATGTTGAAGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4560 C. elegans acdh-12(gk5631[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2565 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTGAAGAGTGAGTCCTCCATTTCCACAG. Right flanking sequence: GGAGGACGGTCATTGTTATCTCTTGTAGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4561 C. elegans cox-7C(gk5632[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5024 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1095 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACATCAAAGTCAGAGTTTTATGGCTCACCG. Right flanking sequence: GGGGCTTGTAAGATGAGAAGCACCCGTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4565 C. elegans psmd-9(gk5633[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 854 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAACGACATATTTTTAAATGCAATCTTTG. Right flanking sequence: TCCGGTGCTAATGTCTAATGTGATTTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4566 C. elegans timp-1(gk5634[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 690 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACAGGTCGCCAGTTGAACCTTTCCCGGCG. Right flanking sequence: CTTGGAAGAAGTTTGTGGATTCGGTTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4567 C. elegans F02E9.10(gk5635[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAGTTTCAAGCGACGGGTCCACCACCGGTT. Right flanking sequence: TGCGGTATTCCTTCTTCGTTCATCATATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4568 C. elegans F08B4.7(gk5639[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1233 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTCAAAATATTCAGATAATCACACCATGC. Right flanking sequence: GTGTGTCAACAGGGCACGAGAAATACGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.