| VC1207 |
C. elegans |
nhr-280(gk558) III. Show Description
C29F9.13. Superficially wild type. External left primer: GGCATTAGCCGAACAAACAT. External right primer: TATAATACGCGGGTTGCCTC. Internal left primer: TCTTGAGTTGTTCGTGGCTG. Internal right primer: ACCGACTGACCAAACCAAAC. Internal WT amplicon: 1767 bp. Deletion size: 1249 bp. Deletion left flank: AGCACGGATTTTCTGCTAATTAGCAATGGT. Deletion right flank: GCCTTTTCTCGCCTTCGTGGATGACCTACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG5002 |
C. elegans |
+/mT1 [umnIs52] II; psd-1(gk5580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5580 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4509 and CGC66. gk5580 is a 6731 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAAGCTCGACACTTGCCACGTGGACTAA. Right flanking sequence: TCTGGCGGACCGAAGAACGTTGAAAAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5109 |
C. elegans |
sbds-1(gk5584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5584 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4513 and CGC51. gk5584 is a deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTGAGATCCAAAAAGAATTCTCGGGTGTGT. Right flanking sequence: ATTGGTCAGAACTTTCTGATTTGTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4509 |
C. elegans |
psd-1(gk5580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5002 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 6731 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TACAAGCTCGACACTTGCCACGTGGACTAA. Right flanking sequence: TCTGGCGGACCGAAGAACGTTGAAAAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4510 |
C. elegans |
nog-1(gk5581[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGGAATTGTAAGGAATTTCAATCTCCGGAG. Right flanking sequence: TGAGTTTCCCGAATAAAATTCTTCCTGATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4511 |
C. elegans |
perm-2(gk5582[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1999 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAACTACAATGCCGAGTTCCCGCCTCCA. Right flanking sequence: GAAGAGTGTAATTCAACTAATTCCACGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4512 |
C. elegans |
pgam-5(gk5583[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1420 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCCATTTTACCATTTGGTGGGCTCCGCCC. Right flanking sequence: AAAGGAATAAACAAGCATTATTTAAATCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4513 |
C. elegans |
sbds-1(gk5584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTGAGATCCAAAAAGAATTCTCGGGTGTGT. Right flanking sequence: ATTGGTCAGAACTTTCTGATTTGTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4514 |
C. elegans |
erd-2.2(gk5585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1316 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTAGGGTCATCATGAACATCTTCCGTAT; Right flanking sequence: ATATCCATTTATTCAGCTTTTTAAAATAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4515 |
C. elegans |
rga-4(gk5586[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 9831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATGAAAATGAAGGATGGAATGAGAGGAAG. Right flanking sequence: TTTAGTGATTTTAAATTCGATTTTAAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4516 |
C. elegans |
skat-1(gk5587[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1851 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGATGGAATGATCGAAAAAAGTGAGAAAA. Right flanking sequence: AGGTCTGAAAATAAATATATATTAAACATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4517 |
C. elegans |
scvp-1(gk5588[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 619 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAACAGCATATGAAAGTTCATTTGAGTGCT. Right flanking sequence: AGCCATGACTATACATCAAACTGGTAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4518 |
C. elegans |
zgpa-1(gk5589[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1815 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATACGTGTCTGAAATGTTTACATCAGGGTG. Right flanking sequence: GATGTATCGTCAATTTCAGCTGAATCTTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|