| AV311 |
C. elegans |
dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Show Description
Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.
|
|
| QC120 |
C. elegans |
nhr-49(et7) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et7) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et7); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
| JCB435 |
C. elegans |
C14B1.9(bet70) III. Show Description
Homozygous viable. Deletion of 973 bp in parental strain N2. Left flanking sequence: aaactacggtaacacccatt; Right flanking sequence: tgacggatgcaatgacaaga. sgRNA #1: gagacctacacatgccaaat; sgRNA #2: tttggattaatgttacctga.
|
|
| JCB455 |
C. elegans |
K02D10.3(bet75) III. Show Description
Homozygous viable. Deletion of 247 bp in parental strain N2.Deletion appears to have occurred at the sgRNA #2 cut site. Left flanking sequence: tttataggaatttcaggaat; Right flanking sequence: ttccgtcaccttccgtcaaa. sgRNA #1: aaatgataagaagccaaagc; sgRNA #2: tttgtgtttatgacgagctc.
|
|
| JCB456 |
C. elegans |
algn-12(bet74) V/nT1[qls51] (IV;V). Show Description
Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.
|
|
| JCB458 |
C. elegans |
T19C4.5(bet77) V. Show Description
Homozygous viable. Deletion of 1581 bp in parental strain N2. Also contains a SNP (A->T) in right flanking sequence (uppercase text). Left flanking sequence: ctactcatgatataccttct; Right flanking sequence: ccggTgctctcttgttgtct. sgRNA #1: gttttcacatgggcaagaga; sgRNA #2: atttcaattccatttcccac.
|
|