| AV477 |
C. elegans |
dsb-2(me96) II. Show Description
Age-dependent defect in meiotic double-strand break formation. Homozygous mutants produce elevated frequency of males and dead embryos resulting from defects in meiotic chromosome segregation. The frequency of both males and dead embryos increases in later broods. Reference: Rosu S, et al. PLoS Genet. 2013;9(8):e1003674.
|
|
| CB96 |
C. elegans |
vab-2(e96) IV. Show Description
Notched head. Tail abnormalities. Variable expression. Incomplete penetrance. Especially seen in L1. M-MATING++++ >30%WT. See also WBPaper00003843 and WBPaper00003865. Previously called efn-1(e96).
|
|
| DG2361 |
C. elegans |
vab-2(e96) efn-2(ev658) IV; efn-3(ev696) X. Show Description
[NOTE: this strain is carrying vab-2(e96), not vab-2(e961)]
|
|
| EU3068 |
C. elegans |
ebp-2(or1954[ebp-2::mKate2]) II; ruIs57. Show Description
ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Superficially wild-type. mKate2 was inserted into the C-terminus of ebp-2 endogenous locus. Reference: Sugioka K, et al. (2018) PNAS, Jan 30;115(5): E954-E963. (PubMed ID: 29348204)
|
|
| RG3460 |
C. elegans |
B0281.8(ve960[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1112 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGTCATATTTTTTTGCTTCTCTATCGCCT ; Right flanking sequence: TCGCAGATTTCGCATTTTGGCACTTGCATT. B0281.8 sgRNA A: GAGACATGTTAAAGATATTG; B0281.8 sgRNA B: TGATGACTTCTCAAGTGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3461 |
C. elegans |
pfk-1.1(ve961[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 4271 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAAATACTATTGTCATAAATTACAGAATTT ; Right flanking sequence: CGACCGTTGAAAGTTCTGCAATTTTGGAAT. pfk-1.1 crRNA A: TGCATAATTCGAAATGGACG; pfk-1.1 crRNA B: AACGATGACGAGCGAGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3462 |
C. elegans |
ndub-8(ve962[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2603 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve962 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CAATAAAATTCGATTGCTGATAGCGTCACA; Right flanking sequence: CTCTCCTCGCCTGGTACTTTACCAACGAAC. ndub-8 sgRNA A: AGACCGGTTCACGTGATAGG; ndub-8 sgRNA B: CCATCGGTACGAGCACGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3463 |
C. elegans |
F40G9.12(ve963[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTATGTATTGCGAGTGCAGAAATAATA ; Right flanking sequence: TGAGGATTGTAAGGAGCACGAGTGTAAAGC. F40G9.12 sgRNA A: TATTTCAACGAACACGGAGA; F40G9.12 sgRNA B: CAGACACTTTTACCACAGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3464 |
C. elegans |
enpp-1(ve964[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 4885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttttaaaattcttctaatatttgctagccg ; Right flanking sequence: tatcgggtcattcaatctttgcaggatttc. enpp-1 sgRNA A: acggtgagaacgatagagaa; enpp-1 sgRNA B: tgaaacaagtggagtgaggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3465 |
C. elegans |
col-14(ve965[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1019 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATATTCAAACTTTGGAATCTCAAGTTCA ; Right flanking sequence: aggataattttgatttgtatacttacgttt. Note that col-14 resides in the 6th intron of C46A5.4 and it is not known whether this indel alters its expression. col-14 sgRNA A: ACTTGATCTTGAATTCTGCC; col-14 sgRNA B: tgtttgtatcgaaaatctgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3466 |
C. elegans |
cpr-4(ve966[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATGATGGTGCTGCGTCACATGACTACCT ; Right flanking sequence: CATTGCAAAAAATGAAAGCCCCCAATTTTT. cpr-4 crRNA A: ATAGACAATGCCTAATTAGG; cpr-4 crRNA B: AAATGATATTACCCGGAGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3467 |
C. elegans |
zipt-1(ve967[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATACACAGGTCTATGGCGAGCTGGAACCC ; Right flanking sequence: GAGAATATGGCTCCGCGCCCATTCTCCTTT. zipt-1 crRNA A: TTCTTGTACTTTCTCATCCC; zipt-1 crRNA B: TCGTTCATCTCGTGCATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3468 |
C. elegans |
C34H4.5(ve968[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1781 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGCTAATGGGTTTCTGGATGATTAGCC ; Right flanking sequence: CGGGCGATCTTGATGAAGGTCAACTTTCGA. C34H4.5 sgRNA A: GTGAACAATATGCAAAGCTC; C34H4.5 sgRNA B: aaaaGCGAAATTTATCGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3469 |
C. elegans |
C31H5.6(ve969[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3336 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGTTTTAATGGTGCATTAACAATGAAAAGA ; Right flanking sequence: tggtttttttataaacatttgtcacagtta. C31H5.6 crRNA A: CGAGTCCAATCAGGCATTGG; C31H5.6 crRNA B: aattcattgtaaggctaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|