| CB2627 |
C. elegans |
lin-4(e912)/dpy-10(e128) II. Show Description
Heterozygotes are WT and segregate WT, Dpy and Vulvaless. Maintain by picking WT.
|
|
| DR721 |
C. elegans |
lin-4(e912) II. Show Description
Completely vulvaless. Long. Uncoordinated. Somewhat clear.
|
|
| MT1538 |
C. elegans |
lin-28(n719) I; lin-4(e912) II. Show Description
|
|
| MT18023 |
C. elegans |
lin-4(e912) II; mir-237(n4296) X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT3316 |
C. elegans |
lin-4(e912)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
|
|
| MT5790 |
C. elegans |
lin-4(e912) II; nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Vul. Integrated on IV near dpy-20.
|
|
| MT862 |
C. elegans |
lin-4(e912) II; lin-14(n360) X. Show Description
|
|
| RG3412 |
C. elegans |
B0393.6(ve912[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATTGGGAGTAATATGAAGAGTTCTGGAAG ; Right flanking sequence: CGGAAAAGTTGCGGAGCGAGCATCATATTC. B0393.6 sgRNA A: GTAAAATGAGGTCAAAATGA; B0393.6 sgRNA B: GGCACGGCCTGACAATATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VT509 |
C. elegans |
lin-4(e912) II; maEx114. Show Description
maEx114 [lin-4(+) + rol-6(su1006)]. Pick Rollers to maintain. lin-4 loss-of-function is rescued by the maEx114 extrachromosomal array expressing lin-4 microRNA. Reference: Lee RC, et al. Cell. 75, 843-854.
|
|
| VT573 |
C. elegans |
lin-4(e912) II; lin-14(n179) X. Show Description
lin-14(n179) is temperature-sensitive. lin-4; lin-14 double mutant may be maintained at 20C.
|
|