Search Strains

More Fields
Strain Species Genotype Add
CB12 C. elegans dpy-9(e12) IV. Show Description
Dpy.
FX30269 C. elegans dpy-9(tm9713) kvs-5(tmIs1245) IV. Show Description
Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Dpy. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
MT628 C. elegans dpy-9(e12) unc-17(e245) IV. Show Description
Dpy. Unc.
RW3568 C. elegans pat-6(st561)/dpy-9(e12) IV. Show Description
Heterozygotes are WT and segregate WT, Dpys and Pats. Maintain by picking WT and checking for correct segregation of progeny.
VC1180 C. elegans gex-2(ok1603)/dpy-9(e12) IV. Show Description
F56A11.1. Homozygous lethal deletion chromosome balanced by morphological marker. Heterozygotes are WT, and segregate WT, Dpy (dpy-9 homozygotes), and ok1603 homozygotes (probably sterile adult with protruding or ruptured vulva). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTCACCCTCTCTCCCACCT. External right primer: AAGCAGTGGGTTGAAAAACG. Internal left primer: CAGCTGAAAAATGAACGCAA. Internal right primer: GTGTTGGCCGCTGTATCTTT. Internal WT amplicon: 2748 bp. Deletion size: 1903 bp. Deletion left flank: AAACATACCAGATGTTTTGCAGCTTCTCGA. Deletion right flank: GCAAATTTGGCAAATTTGCCGAGCTCGGCA. Insertion Sequence: ATTTGGCAAATTTGGCAAATTTGCCGGCAAATTTGGCAAATTTGCCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC137 C. elegans R02D3.5(ok269)/dpy-9(e12) IV. Show Description
R02D3.5. Heterozygotes are WT and segregate WT, Dpy-9 and grotty sterile adults with vulval blip (ok269 homozygotes). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MT4954 C. elegans dpy-9(e12) ced-2(e1752) unc-33(e204) IV. Show Description
Dpy. Unc. Abnormal Cell Death.
MT6025 C. elegans lin-31(n301) II; dpy-9(e12) IV; unc-51(e369) V. Show Description
Mapping strain.
MT6996 C. elegans dpy-9(e12) ced-2(e1752) lin-1(e1275) IV. Show Description
Dpy. Temperature sensitive Muv. Abnormal cell death.
RG3131 C. elegans ears-2(ve631[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) /dpy-9(e12) IV. Show Description
Homozygous sterile, Pvl. Deletion of 1629 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ non-Dpy Pvl sterile adults (ve631 homozygotes), Dpy non-GFP (dpy-9(e12) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: acaatggaaatcggagTTATAATAATTCCT ; Right flanking sequence: CGGTTAGCTTCATaatttctattgaggggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3479 C. elegans rpl-15(ve979[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/dpy-9(tm9713) kvs-5(tmIs1245) IV. Show Description
tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 879 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested early larvae (ve979 homozygotes), and Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain. [NOTE: ve979 deletion also removes K11H12.12 and K11H12.13, each of which encodes a snoRNA.] Left flanking Sequence: GAAAACTTTGGTGTTCTTTCTCTTCCAGTT; Right flanking sequence: TGGACGGCGCTCAACTGTCTGTAGTGCCAG. rpl-15 crRNA A: CTTGGCTTGGGATCCTCCGC; rpl-15 crRNA B: TGGTTGGGCGTGGGACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3491 C. elegans rps-24(ve991[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV/dpy-9(tm9713) kvs-5(tmIs1245) IV. Show Description
tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested larvae (ve991 homozygotes),Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain . Left flanking Sequence: aattttaaaactacaattcaaatttatttt; Right flanking sequence: AGACTCGTTCGCgtaagttacttttctgaa. rps-24 crRNA A: gcaggtaatattcatcacgA; rps-24 crRNA B: GTACTTCGGCTCAAACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.