Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
EU3020 C. elegans cls-2(or1948)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. or1948 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1948 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.
EU3023 C. elegans cls-2(or1951)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. or1951 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1951 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.
RG3473 C. elegans cls-1(ve973[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 7096 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTATAAATGTATGACTCACACTTTTTCCG ; Right flanking sequence: TGGGCCGCGCCAAGTCATCCGAATCAGGAG. cls-1 crRNA A: AGAGAAAACCCCCGTTGTTT; cls-1 crRNA B: GAACCTAATTGACCTGTACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.