Search Strains

More Fields
Strain Species Genotype Add
FX19472 C. elegans tmIn10 II. Show Description
Break points: In(ZK1240.1 F29A7.8) II. Covered region (Mb) 0.4 (2.3..2.8) Obtained by TMP/UV. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19668 C. elegans tmC6 [dpy-2(tmIs1189)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30138 C. elegans tmC6 [dpy-2(tmIs1208)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30143 C. elegans tmC6 II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30144 C. elegans tmC6 [dpy-2(tm9710)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
RB2168 C. elegans ZK1240.2(ok2935) II. Show Description
ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2209 C. elegans ZK1240.2(ok2991) II. Show Description
ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3403 C. elegans ZK1240.9(ve903[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1214 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttgttcaatttatcgcgtgtgtggcaa ; Right flanking sequence: CGCAGGCATTGGCCAAGTTGAAAACTATCG. ZK1240.9 sgRNA A: atttccaaccttgccgaact; ZK1240.9 sgRNA B: ACGGCTTTATGAAGAAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3498 C. elegans ZK1240.5(ve998[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1535 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGCGCTGATATTTTGAAGCGCACAAAAACC ; Right flanking sequence: GCAAAATGGGCATACAATTCTGCCGTTGTT. ZK1240.5 sgRNA A: GAATGTGCACATAGAAAGTC; ZK1240.5 sgRNA B: CGCGAACCAACTGAGATACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3499 C. elegans ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 398 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTGAAAATTAATATTAGGTACCTGACCT ; Right flanking sequence: ACTTGGAAATTGGAGAGCAAGTAAAAGTTA. ZK1240.6 sgRNA A: ACTTCAGAACCTGATATGCA; ZK1240.6 sgRNA B: TAGTCGAGTTATTCGTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3505 C. elegans tsr-1(ve1005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Sterile. Deletion of 7616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry sterile adults (ve1005 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Note: tsr-1 is near ZK1240.1, the gene marking the breakpoint of the tmC6 balancer. Left flanking Sequence: aaatTTAGATGAACAGCTTGGCGAGATCAC; Right flanking sequence: tagtgagctctagttttcggtgtctaggct. tsr-1 crRNA A: GAGTATGGTTGAAGACGGCG; tsr-1 crRNA B: gctcaattttgaagtctcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3538 C. elegans ZK1240.8(ve1038[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1716 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTAATCCTCTTTTCCCTTTCATCAACCA ; Right flanking sequence: ATTAGATAACAAAATAGATTAGTAAGAGTA. ZK1240.8 crRNA A: TTTCAGTAGAATCCGTCAAT; ZK1240.8 crRNA B: GCTCCTTTAGTGACATGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.