More Fields
Strain Species Genotype
RB1245 C. elegans rga-1(ok204) II. Show Description
W02B12.6. Homozygous. Outer Left Sequence: TCCGGTTGAATACACGTTGA. Outer Right Sequence: CTTGCGCTGATGTATCCAGA. Inner Left Sequence: TAAACTGGTAATCCCCGTCG. Inner Right Sequence: AAACTTCGGCAGTTGGAAGA. Inner Primer PCR Length: 3083 bp. Deletion Size: 994 bp. Deletion left flank: ATTGAAATGACATTTTTGGCGAGCGCCGCG. Deletion right flank: GCAGGCCAATTGTTGTCGTATATGCTTATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1651 C. elegans D2023.5(ok2040) V. Show Description
D2023.5. Homozygous. Outer Left Sequence: AACGATGCACCATGAACGTA. Outer Right Sequence: AGCAGCTCTCCCAAATCTCA. Inner Left Sequence: CAACTCAGCCAGCTTCTTCC. Inner Right Sequence: CCGGGCTGAAAATAACTGAA. Inner Primer PCR Length: 2110 bp. Deletion Size: 570 bp. Deletion left flank: TATTGTTCAATCCAACCATTTGAGCATATT. Deletion right flank: TCTGCAATCAATGGAGCGCACTTGCGTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1652 C. elegans D1081.4(ok2041) I. Show Description
D1081.4. Homozygous. Outer Left Sequence: CTTTGAATAAAACGCACGCA. Outer Right Sequence: AAAGTGTGGGTCGTCGAGAT. Inner Left Sequence: CGTGCTCACCTGAAACAAAA. Inner Right Sequence: GCAGTTTTGGGAGCAGAAAG. Inner Primer PCR Length: 3047 bp. Deletion Size: 2555 bp. Deletion left flank: ATCGCCGCAATGTATAACAATGCAATTTCA. Deletion right flank: GATGGGCTCCAGTGCTGTGAAAAATTCGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1653 C. elegans ctl-3(ok2042) II. Show Description
Y54G11A.13. Homozygous. Outer Left Sequence: CGGCGATTCTTATACTCCCA. Outer Right Sequence: CTTCCCCACATGGTCAATCT. Inner Left Sequence: GGCCAATTTTCTGCCTGATA. Inner Right Sequence: CAACTGCTTTCGCATGGTTA. Inner Primer PCR Length: 2912 bp. Deletion Size: 1420 bp. Deletion left flank: CATTTCCGAAATCCGGATGAACTTTCGTGAACTCTTTGACCATTCCATTTTGAATTTCC TCCAAACAGCCACCCAAATCACTAGCCAAATTCCCAACGAGCCGATCTCTCTCCTCCTC CTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTAGTTGTGATCGTCTCCAGT. Deletion right flank:  ATGGATTGAACTCCCATTTCTCAGCTTGTTCGAATGTCATCACTTGAATGAACATCTTC CATTCCGGGAAATTTCTTGACTCAATGGCATTGAACAGGTCGCGGATCGCATAGTCTGG ATCCGAAGAGGCGAGCTTTCCAGCGTCAGTTGGATCGAGATTCTTGGAACCTTGAGCAG GCTGAAAAATAGAAAATGAAAATTTAATTCTAGTCCCCGTCTCTCTTAGGCTTACCTTG . Insertion Sequence: GGATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1654 C. elegans F31E3.2(ok2044) III. Show Description
F31E3.2. Homozygous. Outer Left Sequence: ATTCGAAAGTCCACCGTCTG. Outer Right Sequence: CATTTCTTCCGCAACTCACA. Inner Left Sequence: GATGGACCAGCGAAGAAAAG. Inner Right Sequence: GGGCGTGAAGAACAGTGAAT. Inner Primer PCR Length: 2860 bp. Deletion Size: 1289 bp. Deletion left flank: AAATACATTTGTGACGTCACAAATGTATTT. Deletion right flank: TGTGGTAGGAACTATTTTCATTCACTTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1655 C. elegans mps-3(ok2045) I. Show Description
T06A4.2. Homozygous. Outer Left Sequence: ACACTTTACGGTTTCCACGC. Outer Right Sequence: TACCTACCTGCCTACCCACG. Inner Left Sequence: CCTGCCTACCTGCCTACAAG. Inner Right Sequence: CTGCCTACCTGCCTATCTGC. Inner Primer PCR Length: 2411 bp. Deletion Size: 1559 bp. Deletion left flank: CAATGCTTTTTCTACAATTTTGTGGTTAAA. Deletion right flank: AGGCAAGTAGGCAGTTAGGCAGGTAGGCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1656 C. elegans F54D5.4(ok2046) II. Show Description
F54D5.4. Homozygous. Outer Left Sequence: CCGATGAGCAGCTGTTGTTA. Outer Right Sequence: AAAGGGAAAATTGCAACGTG. Inner Left Sequence: ACGGTATGTCGTCCGATTTG. Inner Right Sequence: AGCAATGCGGAGACAGTTTT. Inner Primer PCR Length: 2218 bp. Deletion Size: 1180 bp. Deletion left flank: CCAAACTTCAATTGCCACTTAGATAAGAAT. Deletion right flank: TTTCTCAGAACTCAGAATATTAATCAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1657 C. elegans R04F11.1(ok2047) V. Show Description
R04F11.1. Homozygous. Outer Left Sequence: AAATGGCCGATGTGATTGAT. Outer Right Sequence: TTCTCCGTGGGAATTTCAAG. Inner Left Sequence: GCCCATTGTTTTTCCATCTG. Inner Right Sequence: GCCAAAATTTCGAAACTGGA. Inner Primer PCR Length: 2447 bp. Deletion Size: 1294 bp. Deletion left flank: CATGGAACCAAACATGTGTATGTACGTTGC. Deletion right flank: CCTTAGGGCCTGGAACAGCTGAGAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1658 C. elegans Y67D8C.10(ok2048) IV. Show Description
Y67D8C.10 Homozygous. Outer Left Sequence: ttctacggccattcttccac. Outer Right Sequence: tgacaaaacgggaacactca. Inner Left Sequence: gcttgaagctcgtctcatcc. Inner Right Sequence: gattcgtacttgcccttgga. Inner Primer PCR Length: 3172. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1659 C. elegans acr-3(ok2049) X. Show Description
K11G12.7. Homozygous. Outer Left Sequence: CGATTTAAGCAAGACGGAGC. Outer Right Sequence: ACAGGCCAAAGTCTCGAAAA. Inner Left Sequence: GGACCCTCCAGTCTGTTTTG. Inner Right Sequence: CGCGGATAAAAGTATTCCGA. Inner Primer PCR Length: 3245 bp. Deletion Size: 2190 bp. Deletion left flank: ACGAAACATTTTTTGGTCCATTTTGTTTAT. Deletion right flank: GTGGTGATTGATCGATTACTTCTCTATCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1594 C. elegans mec-8(ok2043) I. Show Description
F46A9.6. Superficially wild type. External left primer: ATAGCAAGTGTGTGAGGGGG. External right primer: CCGACACAACATTCGACATC. Internal left primer: CCTCGATCGTTGGCTGTTAT. Internal right primer: ATTTCTTTGTCGCCCCTTTT. Internal WT amplicon: 2265 bp. Deletion size: 1117 bp. Deletion left flank: TCGTTGGCTGTTATCTGGAATCCTTGTAGT. Deletion right flank: TGTTGCTCATTGAAAAGAGCTGCTGATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807