Search Strains

More Fields
Strain Species Genotype Add
RB1497 C. elegans F44F1.1(ok1765) I. Show Description
F44F1.1 Homozygous. Outer Left Sequence: gttgagtcttttaccccgca. Outer Right Sequence: cattgattgcacggatgaag. Inner Left Sequence: caaaattgtctactgcgcca. Inner Right Sequence: cttcgcgacaatcctaggtc. Inner Primer PCR Length: 3063. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1500 C. elegans ulp-1(ok1768) III. Show Description
T10F2.3 Homozygous. Outer Left Sequence: ccacagtcactgccattttg. Outer Right Sequence: caaaaatgatctgcagccaa. Inner Left Sequence: tccaatgattcagcttccaa. Inner Right Sequence: ctccgcttctatcccattca. Inner Primer PCR Length: 3283. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1502 C. elegans Y58G8A.1(ok1770) V. Show Description
Y58G8A.1 Homozygous. Outer Left Sequence: ggtcccctgcttgaaaactt. Outer Right Sequence: aaaagacgcgacaagatgct. Inner Left Sequence: tgcaaatttgatggcacagt. Inner Right Sequence: cctctgcgatggaatgaaat. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1503 C. elegans cpb-2(ok1772) II. Show Description
C30B5.3 Homozygous. Outer Left Sequence: aacagcaaaatgccaaatcc. Outer Right Sequence: aaaacgtctccgaacaccac. Inner Left Sequence: ggaattccagcactccattg. Inner Right Sequence: agatttcggtcgcttcaaga. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1509 C. elegans clp-6(ok1779) IV. Show Description
Y77E11A.10. Homozygous. Outer Left Sequence: TGCTTTCTAGGCCCACTTGT. Outer Right Sequence: CCTTGTTGGGTCATTTCCAC. Inner Left Sequence: TCGAAATTTGGACCTTCTCG. Inner Right Sequence: ATTTTCCAGCCAACAACTCG. Inner Primer PCR Length: 3274 bp. Deletion Size: 2386 bp. Deletion left flank: TTTTTTTGGGACGAAAAAATTCGCAAAAAA. Deletion right flank: GGATCCTTGTCTAACATCGAATCGGCTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1534 C. elegans npp-16(ok1839) III. Show Description
Y56A3A.17. Homozygous. Outer Left Sequence: CACTGAAACAGTGCGGAGAG. Outer Right Sequence: AGACGCTGAAAGAGGTTCCA. Inner Left Sequence: TGACTCATCGAGCCTGAAAA. Inner Right Sequence: GAGTCGAACTTCCCAAGCAG. Inner Primer PCR Length: 2218 bp. Deletion Size: 1120 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1542 C. elegans C31H1.6(ok1852) IV. Show Description
C31H1.6. Homozygous. Outer Left Sequence: CCAAAGTCTCCTGCCCATTA. Outer Right Sequence: ACATACCACCCGCTTTCTTG. Inner Left Sequence: TTCAAACAATGATACCCGCA. Inner Right Sequence: TTTTGAGGGAAATGCGAAAC. Inner Primer PCR Length: 2666 bp. Deletion Size: 1117 bp. Deletion left flank: TATCAAAGTTTTTTTTTAATGAACTCTATA. Deletion right flank: AAAAGTAGTTTGAAGGTTTAAATTTGATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1544 C. elegans F11A5.4(ok1857) V. Show Description
F11A5.4. Homozygous. Outer Left Sequence: TGCTATGGAAGCGACTGTTG. Outer Right Sequence: TGCTTGCTTCATTTTTCACG. Inner Left Sequence: TTATCCCTTTTCCCCATTCC. Inner Right Sequence: ATACCTGCCATTGGACTTCG. Inner Primer PCR Length: 2332 bp. Deletion Size: 658 bp. Deletion left flank: CACGAGATTTATAGAAAGCTTAACTTTGGA. Deletion right flank: TATGCGCATGGTGGTCTTTGCCGAGTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1550 C. elegans K08D12.2(ok1863) IV. Show Description
K08D12.2. Homozygous. Outer Left Sequence: AGTGGAATTTGTGGTCTCGC. Outer Right Sequence: AGAAGAGGGCTCGGAAAAAG. Inner Left Sequence: ATTTCGCTGCAAGACCTGTT. Inner Right Sequence: AGGTCGTTCTCGGACATCAC. Inner Primer PCR Length: 2681 bp. Deletion Size: 1137 bp. Deletion left flank: CCAGGACTCAACAATCCTGTACCTCTACCA. Deletion right flank: TCGAACTTCTTCACGCGATCTACAAGTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1556 C. elegans shw-3(ok1884) V. Show Description
R186.5. Homozygous. Outer Left Sequence: ACCGGAGCATGTTTTACCTG. Outer Right Sequence: AGTACCGAGCCTCCCAATCT. Inner Left Sequence: ACGAATGCCTCCCCTAGAAT. Inner Right Sequence: CCCTTCATTCTCTGCTCTGG. Inner Primer PCR Length: 3307 bp. Deletion Size: 1112 bp. Deletion left flank: AAACTTTAAAATGAAGCTTCAAAATTTCAA. Deletion right flank: TCACTTTGGAGTCGACTACGGTAGGAGGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1559 C. elegans acr-2(ok1887) X. Show Description
K11G12.2. Homozygous. Outer Left Sequence: GGGTCCGTCCTTTAGACCAT. Outer Right Sequence: TGTTGTTGCTGGAGCAATTC. Inner Left Sequence: CCCTGCATATGTGTGAAACG. Inner Right Sequence: CGCTTTTCCAGTTTTTGACC. Inner Primer PCR Length: 3281 bp. Deletion Size: 2857 bp. Deletion left flank: AAAGAAGTGAAGCGGCTCTACCACCCCGAC. Deletion right flank: AGAAATCATGTTTGGAAAACAAAAATATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1566 C. elegans F09A5.2(ok1900) X. Show Description
F09A5.2. Homozygous. Outer Left Sequence: TGAATTCGCAGAGATCAACG. Outer Right Sequence: AGCACAAGTTCCTTGCGAGT. Inner Left Sequence: AAACAGCCCACCCCTATCTC. Inner Right Sequence: TCATAATCCCCGTCTTCGTC. Inner Primer PCR Length: 3232 bp. Deletion Size: 1135 bp. Deletion left flank: GCTATGTATACATTTTTGCTGAAGATTGTA. Deletion right flank: CGAGCAGAACCATTTGGATTTTTTCCATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1572 C. elegans mlh-1(ok1917) III. Show Description
T28A8.7. Homozygous. Outer Left Sequence: TTGGCACTGCTTGTAAAACG. Outer Right Sequence: CCGTAACCCAATACCCAACA. Inner Left Sequence: TATGTTCCACATCGCTCGAA. Inner Right Sequence: CAGTTGCTAGATGGGTGCAA. Inner Primer PCR Length: 3200 bp. Deletion Size: 1100 bp. Deletion left flank: ACGCCGATATTTTCTTATCGAGTGTGATGA. Deletion right flank: TTTTAAATTTTGGGATTCTAGGCCACCAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1589 C. elegans mls-1&H14A12.6(ok1948) III. Show Description
H14A12.4, H14A12.6. Homozygous. Outer Left Sequence: ATCATCGCTGGTCTTGATCC. Outer Right Sequence: GAGTCTTTCGTTGCGAGACC. Inner Left Sequence: TCATTGAAAAGGAACCCTCG. Inner Right Sequence: TTTACCCTTCCCGTTGACAC. Inner Primer PCR Length: 2285 bp. Deletion Size: 1183 bp. Deletion left flank: ATAGTTGAAACATTTTTGACTGTAATTAAA. Deletion right flank: TGAATCGTGACTTTTCCGACAAACCGGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1612 C. elegans tat-6(ok1984) V. Show Description
F02C9.3. Homozygous. Outer Left Sequence: GACGGAACACGAGTGGAGAT. Outer Right Sequence: CAAAGCTAGGCGGTGAAAAC. Inner Left Sequence: TGCAGATGTTGTGTTGCTGA. Inner Right Sequence: TGGTGATGAAGACCCATGAA. Inner Primer PCR Length: 3263 bp. Deletion Size: 1195 bp. Deletion left flank: AATGGACAGAAACCGTCGGTGTAAAACTTG. Deletion right flank: CGACAGCGTCCGACAGCGGGCGACAGCGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1615 C. elegans glt-5(ok1987) II. Show Description
Y53C12A.2. Homozygous. Outer Left Sequence: TGAGAATTTGGGAACATCGG. Outer Right Sequence: ATCAATCGTTCCATGCATCA. Inner Left Sequence: ATTTGCTCAGAAAACGGGAA. Inner Right Sequence: ATTCAGCCATCATGGGAATC. Inner Primer PCR Length: 2194 bp. Deletion Size: 1158 bp. Deletion left flank: TCTTCTCAGCTTCTGCAACGTCAGCATTCA. Deletion right flank: TAGTTAGTTTGCACTTGAGAAAATGTTGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1623 C. elegans cdr-2(ok1996) V. Show Description
C54D10.1. Homozygous. Outer Left Sequence: GTTGGTGGCGTGAAGAATTT. Outer Right Sequence: ATTCCGCTGCAAAATTAACG. Inner Left Sequence: TGTCACTGGACAGCAACACA. Inner Right Sequence: AGCGTGTTCGCAAAGAGATT. Inner Primer PCR Length: 2727 bp. Deletion Size: 1109 bp. Deletion left flank: ATTTTGGAATACCAATGCTTCTGACAAGAA. Deletion right flank: AAAAAAAATCAAGAAGAGTTTACAAATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1624 C. elegans Y57G11C.20(ok1997) IV. Show Description
Y57G11C.20. Homozygous. Outer Left Sequence: ATACTCGAGCAGACTGGCGT. Outer Right Sequence: ATAATGTCACCAAGCCCAGC. Inner Left Sequence: AACCGTTTTACCCTGCACAC. Inner Right Sequence: AATCAACCCGGAAGACACTG. Inner Primer PCR Length: 2825 bp. Deletion Size: 1017 bp. Deletion left flank: TTCAGACTGATAAAGACGAACAGCGTGAGA. Deletion right flank: TTGATTTTTTAGATTCAAACATTTTATTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1627 C. elegans pll-1(ok2003) III. Show Description
K10F12.3. Homozygous. Outer Left Sequence: AAAACACCAATCAGGTTCGC. Outer Right Sequence: TGACCGGATAGAATTCGGAG. Inner Left Sequence: CACATGGCAAATTTAGGGCT. Inner Right Sequence: TTCAAGCAGACCATCTGCAC. Inner Primer PCR Length: 3277 bp. Deletion Size: 1120 bp. Deletion left flank: CAATCTCATGACAGTCGACGGCTTCACATC. Deletion right flank: TACCAATATATGTAATAAAGGACGATAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1651 C. elegans D2023.5(ok2040) V. Show Description
D2023.5. Homozygous. Outer Left Sequence: AACGATGCACCATGAACGTA. Outer Right Sequence: AGCAGCTCTCCCAAATCTCA. Inner Left Sequence: CAACTCAGCCAGCTTCTTCC. Inner Right Sequence: CCGGGCTGAAAATAACTGAA. Inner Primer PCR Length: 2110 bp. Deletion Size: 570 bp. Deletion left flank: TATTGTTCAATCCAACCATTTGAGCATATT. Deletion right flank: TCTGCAATCAATGGAGCGCACTTGCGTCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1653 C. elegans ctl-3(ok2042) II. Show Description
Y54G11A.13. Homozygous. Outer Left Sequence: CGGCGATTCTTATACTCCCA. Outer Right Sequence: CTTCCCCACATGGTCAATCT. Inner Left Sequence: GGCCAATTTTCTGCCTGATA. Inner Right Sequence: CAACTGCTTTCGCATGGTTA. Inner Primer PCR Length: 2912 bp. Deletion Size: 1420 bp. Deletion left flank: CATTTCCGAAATCCGGATGAACTTTCGTGAACTCTTTGACCATTCCATTTTGAATTTCC TCCAAACAGCCACCCAAATCACTAGCCAAATTCCCAACGAGCCGATCTCTCTCCTCCTC CTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTAGTTGTGATCGTCTCCAGT. Deletion right flank:  ATGGATTGAACTCCCATTTCTCAGCTTGTTCGAATGTCATCACTTGAATGAACATCTTC CATTCCGGGAAATTTCTTGACTCAATGGCATTGAACAGGTCGCGGATCGCATAGTCTGG ATCCGAAGAGGCGAGCTTTCCAGCGTCAGTTGGATCGAGATTCTTGGAACCTTGAGCAG GCTGAAAAATAGAAAATGAAAATTTAATTCTAGTCCCCGTCTCTCTTAGGCTTACCTTG . Insertion Sequence: GGATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1656 C. elegans F54D5.4(ok2046) II. Show Description
F54D5.4. Homozygous. Outer Left Sequence: CCGATGAGCAGCTGTTGTTA. Outer Right Sequence: AAAGGGAAAATTGCAACGTG. Inner Left Sequence: ACGGTATGTCGTCCGATTTG. Inner Right Sequence: AGCAATGCGGAGACAGTTTT. Inner Primer PCR Length: 2218 bp. Deletion Size: 1180 bp. Deletion left flank: CCAAACTTCAATTGCCACTTAGATAAGAAT. Deletion right flank: TTTCTCAGAACTCAGAATATTAATCAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1658 C. elegans Y67D8C.10(ok2048) IV. Show Description
Y67D8C.10 Homozygous. Outer Left Sequence: ttctacggccattcttccac. Outer Right Sequence: tgacaaaacgggaacactca. Inner Left Sequence: gcttgaagctcgtctcatcc. Inner Right Sequence: gattcgtacttgcccttgga. Inner Primer PCR Length: 3172. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1659 C. elegans acr-3(ok2049) X. Show Description
K11G12.7. Homozygous. Outer Left Sequence: CGATTTAAGCAAGACGGAGC. Outer Right Sequence: ACAGGCCAAAGTCTCGAAAA. Inner Left Sequence: GGACCCTCCAGTCTGTTTTG. Inner Right Sequence: CGCGGATAAAAGTATTCCGA. Inner Primer PCR Length: 3245 bp. Deletion Size: 2190 bp. Deletion left flank: ACGAAACATTTTTTGGTCCATTTTGTTTAT. Deletion right flank: GTGGTGATTGATCGATTACTTCTCTATCTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1664 C. elegans T23B12.4(ok2062) V. Show Description
T23B12.4. Homozygous. Outer Left Sequence: GTGCACGATATGCCTTCTGA. Outer Right Sequence: CCAACCGAGAAAATTCGTGT. Inner Left Sequence: CTCCAAACGAAAGCGAAGAC. Inner Right Sequence: AAAGAAAAACACGGGGGACT. Inner Primer PCR Length: 2929 bp. Deletion Size: 1108 bp. Deletion left flank: CAACGCCTTCAAGTGAAGCAAAATCGGAAA. Deletion right flank: AACTTTGGAACGGAGTCAAGAAATTCAGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1665 C. elegans K11H12.1(ok2063) IV. Show Description
K11H12.1. Homozygous. Outer Left Sequence: CCATGGGACAGACTGGAACT. Outer Right Sequence: CAAACCTACGGAAAGCCAAA. Inner Left Sequence: CTCGAGGGAAGCAGTGACTC. Inner Right Sequence: AGGATCCCAAGCCAAGAACT. Inner Primer PCR Length: 2167 bp. Deletion Size: 1116 bp. Deletion left flank: TACAACTAAAATCGAGCCGCGGCGCGCCGT. Deletion right flank: GAAAAATTGGTAAAGCCTATGAAAAAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1683 C. elegans C36F7.5(ok2093) I. Show Description
C36F7.5. Homozygous. Outer Left Sequence: TGACAAAGCGACCTCTTCCT. Outer Right Sequence: CAGATCCTTCCCTTCCATCA. Inner Left Sequence: CGACGATTGAGCAATGAAGA. Inner Right Sequence: TGCTGCTCAAACTTGATTCG. Inner Primer PCR Length: 2216 bp. Deletion Size: 1115 bp. Deletion left flank: TTGATCTTCTATTTTTTCTTCTTGTCAGCT. Deletion right flank: ATACCTTTCCGCACAAGAACAGAACCTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1689 C. elegans jtr-1(ok2102) IV. Show Description
Y77E11A.4. Homozygous. Outer Left Sequence: TGTTCACGGTGAGTGAGGAG. Outer Right Sequence: GTGGCCTGTGGCCTTAAATA. Inner Left Sequence: GTGGATAGGGCTGTGTCGAT. Inner Right Sequence: TGAGCGTCCTCCTCTCCTTA. Inner Primer PCR Length: 2335 bp. Deletion Size: 618 bp. Deletion left flank: TGCCGCAATTCTCATCGTGAGCTTCTTGTC. Deletion right flank: CATATCTGGGGTAGATTCACGGCGCGTCGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1697 C. elegans C54G4.4(ok2110) I. Show Description
C54G4.4. Homozygous. Outer Left Sequence: TAGGGTTGTTTGGGATTTGG. Outer Right Sequence: ATCCGGTAATGTGGCAATGT. Inner Left Sequence: AATTTGAAAGTTGGTTGCGG. Inner Right Sequence: TTTTCAGCCTTCGAGCTTGT. Inner Primer PCR Length: 3269 bp. Deletion Size: 1789 bp. Deletion left flank: TTCGGATCATTTTCATGATTTTTTAGATCC. Deletion right flank: ACTTCAGTTAAAATATTTTTAAAAAGAAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1699 C. elegans Y38C9A.1(ok2118) V. Show Description
Y38C9A.1. Homozygous. Outer Left Sequence: AGCTTTCTGGCTGTCGGATA. Outer Right Sequence: GCCGCGAATTTTTCATACAT. Inner Left Sequence: ATTTCGCGGAATTACGTCAC. Inner Right Sequence: GCTCCAATGCGGTCAAGTAT. Inner Primer PCR Length: 3291 bp. Deletion Size: 1439 bp. Deletion left flank: ATCGTTAGCAAGATTCTACCGTACCCTGCC. Deletion right flank: AGTTACAAATTAAAAAAAAGCCCAACTCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1700 C. elegans F59F4.1(ok2119) X. Show Description
F59F4.1. Homozygous. Outer Left Sequence: GATAACAATCAGGGCTGGGA. Outer Right Sequence: AATTTAACACTTGCACGGGG. Inner Left Sequence: TCGAGCGTCTTTCATCATTG. Inner Right Sequence: TGCGATAGGGTATGTCACCA. Inner Primer PCR Length: 3067 bp. Deletion Size: 1655 bp. Deletion left flank: CGGTGTTTCCATGTGTAAGCTGCTCGGTGA. Deletion right flank: TTTACCCAAGCCTCCCGGCCACCATCTTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1701 C. elegans clec-34(ok2120) V. Show Description
T25E12.8. Homozygous. Outer Left Sequence: AATCCGCTGATCCAACAAAG. Outer Right Sequence: AATTGGTTTGGGCTCAACTG. Inner Left Sequence: TCTCTCAAGAGGGTCGTCGT. Inner Right Sequence: TCAATTTGGTCTCCCTCCAG. Inner Primer PCR Length: 2159 bp. Deletion Size: 1155 bp. Deletion left flank: TCAAATAGGATTACAGGAAAATAATGCGAT. Deletion right flank: CAGAATTCAATGTTCACTAATCAATAGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1706 C. elegans nhr-244(ok2131) I. Show Description
ZK1025.6. Homozygous. Outer Left Sequence: GGAGATCATTTCCGCGATTA. Outer Right Sequence: CAACCCGAAAACTGTCCTGT. Inner Left Sequence: AAAACTAAGCTCACGGCGAA. Inner Right Sequence: AAGATGGTATCGGGTAGGGC. Inner Primer PCR Length: 2176 bp. Deletion Size: 1178 bp. Deletion left flank: ATGCTAGACAAGGAAGATGTGGAGGTTCTG. Deletion right flank: AAAAATATATCCAAAACCCCGATGCACCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1715 C. elegans aqp-2(ok2159) II. Show Description
C01G6.1. Homozygous. Outer Left Sequence: ACAGAGAAAAGGTGCAACCG. Outer Right Sequence: CTGCTCAAGGGTCACAATGA. Inner Left Sequence: CAGGGTGAGAAAGGATTTCG. Inner Right Sequence: CCTCCCAACTTCACCTTTCA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1238 bp. Deletion left flank: AACAATTGGAACCCAGAACCACTTGCTGAA. Deletion right flank: TTTATTACCAGTAAATTGTCCACTCTTCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1719 C. elegans Y45F10D.13(ok2174) IV. Show Description
Y45F10D.13. Homozygous. Outer Left Sequence: CCGAAAAATCAGCCCACTAA. Outer Right Sequence: AATTGCCGTTTCACAAGTCC. Inner Left Sequence: AATTTCAGCCCATCATCTGC. Inner Right Sequence: TACATCTCGGATCCTTTCGG. Inner Primer PCR Length: 2960 bp. Deletion Size: 1110 bp. Deletion left flank: TAAAACCCCAAAATCATCATTGAAAATAAA. Deletion right flank: AAATTGATTACTGTTTCAAAAAGTTATTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1731 C. elegans T21B10.1&enol-1(ok2210) II. Show Description
T21B10.1, T21B10.2. Homozygous. Outer Left Sequence: GTCGAAGCTCAAAAGGTTGC. Outer Right Sequence: GAAAGAGTGACGAAGGTCGC. Inner Left Sequence: GTCACAAGACTCCGTGCAGA. Inner Right Sequence: CATGCCGAGAAGAAAAGAGG. Inner Primer PCR Length: 2467 bp. Deletion Size: 1161 bp. Deletion left flank: GAGAATCCACACAAGTTACTGCTTCAGCTG. Deletion right flank: TAATGGGGTCTGCCGTGCCTTTTTTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1745 C. elegans clec-66(ok2230) II. Show Description
F35C5.9. Homozygous. Outer Left Sequence: GCCTCCAATCGTCATTTGTT. Outer Right Sequence: AAACATTGCCGTTCTGCTTT. Inner Left Sequence: ATAAAAGAGCCTGGCGTGAA. Inner Right Sequence: GAGCCCCTTTTGAAGGCTAT. Inner Primer PCR Length: 2401 bp. Deletion Size: 1187 bp. Deletion left flank: CCTCACCATCCCAAGCAGTCACCGATCGAT. Deletion right flank: TTGCCGATTCGTTTGCCGCGCACCCCTGGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1746 C. elegans C15F1.5(ok2231) II. Show Description
C15F1.5. Homozygous. Outer Left Sequence: CACTCCGACAACAGGCAGTA. Outer Right Sequence: AGCACCGCAACTACCTCAAG. Inner Left Sequence: CGGAGTGTCGTTAGCCAGAT. Inner Right Sequence: GCCATCGTTCCATTTGTTCT. Inner Primer PCR Length: 3106 bp. Deletion Size: 1194 bp. Deletion left flank: TGTGTAATTAAATGAGCCGAAAAACTATAC. Deletion right flank: AACCAAGACTTGCAACATTTTTCAAGCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1755 C. elegans gur-3(ok2245) X. Show Description
ZC504.5 Homozygous. Outer Left Sequence: gttggctcaatatggggaaa. Outer Right Sequence: gcgtcgaatacgttggagtt. Inner Left Sequence: ggcggtgagagtaagctttg. Inner Right Sequence: aaatggacgtcaccaaggag. Inner Primer PCR Length: 3321. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1763 C. elegans K11E4.3(ok2266) X. Show Description
K11E4.3 Homozygous. Outer Left Sequence: ttgacttgcaccttcattcg. Outer Right Sequence: agaaacttcatcacgcccac. Inner Left Sequence: gatgccagttgggaaagaaa. Inner Right Sequence: aaaataatgcagtttgcgcc. Inner Primer PCR Length: 2991. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1769 C. elegans mig-2(ok2273) X. Show Description
C35C5.4. Homozygous. Outer Left Sequence: CCGAGGTTTTCGTTTTTCAA. Outer Right Sequence: AATGACTGGGAAACGTCCAA. Inner Left Sequence: TTTTGTTCCACGCTTTGTCA. Inner Right Sequence: ATGATCGGGAAGAAGAGCCT. Inner Primer PCR Length: 2116 bp. Deletion Size: 1192 bp. Deletion left flank: ATTTTCGCCAACTTTTCATTCCCTAACTTT. Deletion right flank: TTTTGTTGAAACTCATAAAACTATATCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1776 C. elegans T11F9.1(ok2284) V. Show Description
T11F9.1. Homozygous. Outer Left Sequence: AAATGTCACGTCATCACCGA. Outer Right Sequence: ACCGTAATCCTCCACCCTCT. Inner Left Sequence: TCTTCCCGTTTCGGAAATAC. Inner Right Sequence: GAAATCGAGGCAAAGGATGA. Inner Primer PCR Length: 3090 bp. Deletion Size: 1665 bp. Deletion left flank: GCTGTGTGCATCATAAATATCCTCGAAAAC. Deletion right flank: CGTGATTCGAAAAAATAGTCTTCATCGAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1779 C. elegans fbxb-67(ok2287) I. Show Description
F49B2.2. Homozygous. Outer Left Sequence: ACAATGCAACACCCTGTCAA. Outer Right Sequence: TCACAGGTGAATGAGAAGCG. Inner Left Sequence: TATCCCAAACAGGTTGCACA. Inner Right Sequence: GGGAAATGAGCTAGAAGGGG. Inner Primer PCR Length: 2132 bp. Deletion Size: 1154 bp. Deletion left flank: CTACTCTTTGCCCCTTATTGCTCTTCTGTA. Deletion right flank: AGGTGAAAGTTTACATAGGACACCCCTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1780 C. elegans rgs-3(ok2288) II. Show Description
C29H12.3. Homozygous. Outer Left Sequence: CAGCATCTACCCGGACATCT. Outer Right Sequence: GGACAGTCAATGAAAGGGGA. Inner Left Sequence: AGAAATCGCAGGATTCCCTT. Inner Right Sequence: CTGATCTTCAAGCGGGAAAG. Inner Primer PCR Length: 3116 bp. Deletion Size: 1843 bp. Deletion left flank: TGTTAGATGTAAATTATAATTACTATGTTG. Deletion right flank: GCCAACGCGATGAACAATCTAGGAAAGGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1783 C. elegans C16C8.21(ok2301) II. Show Description
C16C8.16. Homozygous. Outer Left Sequence: AAGACGACCACACTCTCGCT. Outer Right Sequence: ACACTGGGAAAAATGTTCGG. Inner Left Sequence: TGCCGATACTAAAGTTCCCG. Inner Right Sequence: GGACTACGGTAGGTGGCAGA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1331 bp. Deletion left flank: ATTGTTCGAAAATTTGATGTCGGAATTGAA. Deletion right flank: GACTGTCAAAGCCGAGCTGAATGTGACGAA. Interpretation of sequence data is very speculative, and should be confirmed independently. Predominant band in PCR of mutants, about 600 bp, is probably not the full-length mutant product. Full-length mutant product is more likely a fainter band of about 1770 bp, which correlates well with deduced breakpoints and relative sizes of various bands produced by single-round amplification with external and internal primer pairs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1784 C. elegans dnj-27(ok2302) I. Show Description
Y47H9C.5 Homozygous. Outer Left Sequence: aaatctccaatggatgctcg. Outer Right Sequence: accatggagcaaagaaatcg. Inner Left Sequence: gccggtgtgtcataaggatt. Inner Right Sequence: atccatggttccgatgagtc. Inner Primer PCR Length: 3121. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1788 C. elegans cyp-35A1(ok2306) V. Show Description
C03G6.14. Homozygous. Outer Left Sequence: AAAGCTTTTGTTGGAGGTGC. Outer Right Sequence: TGATTCCTTTTGGAGTTGGG. Inner Left Sequence: GATGCATAGTAAGGAAATCTGGG. Inner Right Sequence: TCCACTACCGAGCTTATGCC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1494 bp. Deletion left flank: TTGATATCCTCAATTCTAAATCAAGCAATC. Deletion right flank: TCACCAGAATACAATTTAAAAACCTTTAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1790 C. elegans D2096.3(ok2317) IV. Show Description
D2096.3 Homozygous. Outer Left Sequence: aactaccgcttatcggctcc. Outer Right Sequence: cacactctgcgaggaaacaa. Inner Left Sequence: gatttttgctcgtagtcccg. Inner Right Sequence: cggtgcaatcataagagcag. Inner Primer PCR Length: 3134. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1799 C. elegans Y71F9B.8(ok2333) I. Show Description
Y71F9B.8. Homozygous. Outer Left Sequence: ACAACCTGATGAGGGGTGAG. Outer Right Sequence: TGCCGGAATTGAAATTCTTC. Inner Left Sequence: TCGTTTGAACAATCGGAACA. Inner Right Sequence: TCCAGACCCTCATCATCTCC. Inner Primer PCR Length: 2841 bp. Deletion Size: 1153 bp. Deletion left flank: TGAAAATCTAGAGTCTTGTAATTGGGACTT. Deletion right flank: ATTTTTTGTAGATCAAACCGTGATGGGACA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1812 C. elegans atn-1(ok84) V. Show Description
W04D2.1 Homozygous. Outer Left Sequence: agatgccattgacaccttcc. Outer Right Sequence: tattctgtctgtaccggacg. Inner Left Sequence: attcacagcctggtgcaact. Inner Right Sequence: atggaatcgcttcgtgtcgg. Deletion size: about 1136 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807