| RB1084 |
C. elegans |
oct-1(ok1051) I. Show Description
F52F12.1 Homozygous. Outer Left Sequence: TATCGGAGTGTCGATGCAAG. Outer Right Sequence: CAGCCTACCTTCGTGCCTAC. Inner Left Sequence: GATTCTCGTTTCTTGGCTGC. Inner Right Sequence: GCAAGAGGCAGGCATAGTTC. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1085 |
C. elegans |
tir-1(ok1052) III. Show Description
F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1086 |
C. elegans |
inx-5(ok1053) X. Show Description
R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1094 |
C. elegans |
tag-52(ok1072) X. Show Description
C02F12.4 Homozygous. Outer Left Sequence: GCAAATACCACCACCACACA. Outer Right Sequence: TATAAACGACGGGAAAACGC. Inner Left Sequence: AAGCTCACCGCAAACTCAAT. Inner Right Sequence: ACATACAGCACGGCATTTGA. Inner Primer PCR Length: 2998. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1115 |
C. elegans |
mec-10(ok1104) X. Show Description
F16F9.5 Homozygous. Outer Left Sequence: tcatttgcagcattttctcg. Outer Right Sequence: atttatcaatcaggcggtcg. Inner Left Sequence: gtccaaggtgtcctccaaaa. Inner Right Sequence: tgaagtttgacacaggcgag. Inner Primer PCR Length: 3339. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1194 |
C. elegans |
grk-1(ok1239) X. Show Description
F19C6.1 Homozygous. Outer Left Sequence: AGGAATGAATCGGAGACGTG. Outer Right Sequence: TTGCCACAGCTTCGTAATTG. Inner Left Sequence: CAGGACAAAACGGAGGTGTT. Inner Right Sequence: AACAGTGGAACAAAGGACGG. Inner Primer PCR Length: 2808. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1232 |
C. elegans |
K04F10.1(ok1291) I. Show Description
K04F10.1 Homozygous. Outer Left Sequence: TGGTGAAATTCCATCAAGCA. Outer Right Sequence: GCATTGAGCTGTGCTGAAAA. Inner Left Sequence: AGTGGAAACCGAAGTTGTGC. Inner Right Sequence: CTCGAGCGAGTCGAGTTTTT. Inner Primer PCR Length: 2128. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1240 |
C. elegans |
C23F12.2(ok1305) X. Show Description
C23F12.2 Homozygous. Outer Left Sequence: atcagcactatctcgcccat. Outer Right Sequence: acgcaaacattgcaaaaatg. Inner Left Sequence: aaaaacgaaaccacagccac. Inner Right Sequence: cagtaacctagtcacgcgca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1253 |
C. elegans |
ifb-1(ok1317) II. Show Description
F10C1.2b Homozygous. Outer Left Sequence: aaaaatgggcgtgttcagtc. Outer Right Sequence: aaccgtcgaccaattctgac. Inner Left Sequence: ccgaaggatgcagaaacatt. Inner Right Sequence: gtgggcggagtcaactaaag. Inner Primer PCR Length: 3015. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1280 |
C. elegans |
F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). Show Description
F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1284 |
C. elegans |
C30F12.6(ok1381) I. Show Description
C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1295 |
C. elegans |
F10C1.5(ok1394) II. Show Description
F10C1.5 Homozygous. Outer Left Sequence: acacacccagaagaccatcc. Outer Right Sequence: tgagcattccttttgggaac. Inner Left Sequence: tgcttttcccgttcaaactt. Inner Right Sequence: cagaatgcctgtttctccgt. Inner Primer PCR Length: 2208. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1328 |
C. elegans |
dsh-1(ok1445) II. Show Description
C34F11.9. Homozygous. Outer Left Sequence: ATTCTTCCATCCAATGCCAC. Outer Right Sequence: AGTGCATCATGAGCCACAAG. Inner Left Sequence: TGCTCTAGAGGGTTTTCGGA. Inner Right Sequence: GAGAACGACACGATTGCTCA. Inner Primer PCR Length: 3156 bp. Deletion Size: 1132 bp. Deletion left flank: CGGATTCGGAGCCAATTGTTGATTCTTCGA. Deletion right flank: AATGGTGCCTCAGACTCCGGCTCCACACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1366 |
C. elegans |
F14D12.5(ok1551) X. Show Description
F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1369 |
C. elegans |
F14D12.5(ok1554) X. Show Description
F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1379 |
C. elegans |
F11C7.1(ok1564) X. Show Description
F11C7.1 Homozygous. Outer Left Sequence: gcaaacgccaataactggat. Outer Right Sequence: atgtgaaagcctacgccaac. Inner Left Sequence: tgcctgatctctcattgtgc. Inner Right Sequence: atccaattcggtggactcag. Inner Primer PCR Length: 3214. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1402 |
C. elegans |
far-4(ok317) V. Show Description
F15B9.2 Homozygous. Outer Left Sequence: acggagaagaaccaagcaga. Outer Right Sequence: ttcaaacgtgtgatgaggga. Inner Left Sequence: ggcggttcaattcttccata. Inner Right Sequence: agagtggtggcattacctcg. Inner Primer PCR Length: 3041. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1406 |
C. elegans |
npp-11(ok1599) I. Show Description
F53F10.5 Homozygous. Outer Left Sequence: ttttaggccatcattttcgc. Outer Right Sequence: cgacgagttgttcgttttca. Inner Left Sequence: ctgctaccacaacagcctca. Inner Right Sequence: tgtggtcatccttcagcttg. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1410 |
C. elegans |
Y45F10B.8(ok1607) IV. Show Description
Y45F10B.8 Homozygous. Outer Left Sequence: cgaaaagcttgcattcacaa. Outer Right Sequence: aggagacccaggaaaccact. Inner Left Sequence: aatcacacctggtctggagg. Inner Right Sequence: gtctcgatgcgtcttgatga. Inner Primer PCR Length: 2233. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1413 |
C. elegans |
Y51F10.2(ok1610) I. Show Description
Y51F10.2. Homozygous. Outer Left Sequence: CTTCAGAGCCGTAGGTCAGG. Outer Right Sequence: ACGTTGCACCATGTTCAAAA. Inner Left Sequence: AAAACTGGCGGTATTGATGC. Inner Right Sequence: TTCTGATCCTCCCCCTTCTT. Inner Primer PCR Length: 2508 bp. Deletion Size: 1161 bp. Deletion left flank: CAATTTGCACAAAGTGCAACGCGATTTTCG. Deletion right flank: AATTTTGAGTATAAAATATAATTATCTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1435 |
C. elegans |
F13G3.5(ok1638) I. Show Description
F13G3.5 Homozygous. Outer Left Sequence: ggctcgaaatcgacatgagt. Outer Right Sequence: ttcacaatctggagtgctgg. Inner Left Sequence: cagataaatcgcgtccgagt. Inner Right Sequence: attgaacgaaaaggctggaa. Inner Primer PCR Length: 2192. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1474 |
C. elegans |
F19G12.3(ok1725) X. Show Description
F19G12.3 Homozygous. Outer Left Sequence: ccgagctccttcaaagtcac. Outer Right Sequence: gcctgcaactgcactaatca. Inner Left Sequence: gctcattttcataacgggga. Inner Right Sequence: agtgtaccctgcattttggc. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1478 |
C. elegans |
F13B12.3(ok1729) IV. Show Description
F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1479 |
C. elegans |
F13B12.3(ok1730) IV. Show Description
F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1486 |
C. elegans |
F13G3.5(ok1743) I. Show Description
F13G3.5. Homozygous. Outer Left Sequence: GGGGGAAATGATGGAAGATT. Outer Right Sequence: TACATCGCAAAATGGGACAA. Inner Left Sequence: GAGAATTGGCGGTAAACGAG. Inner Right Sequence: TTCACAATCTGGAGTGCTGG. Inner Primer PCR Length: 3451 bp. Deletion Size: 1259 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1507 |
C. elegans |
Y39F10A.3(ok1777) II. Show Description
Y39F10A.3. Homozygous. Outer Left Sequence: CAACGTCGTGGTATTCGTTG. Outer Right Sequence: AATCGCGAGACAAGAAGCAT. Inner Left Sequence: GATCTGAGGACGCAAATGGT. Inner Right Sequence: TGAGCCATTGACAGAAGCAG. Inner Primer PCR Length: 2145 bp. Deletion Size: 930 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1520 |
C. elegans |
F15E6.6(ok1816) IV. Show Description
F15E6.6. Homozygous. Outer Left Sequence: tcctctcacaacatgccaaa. Outer Right Sequence: tcagtagcaacccgtaaccc. Inner Left Sequence: agtgctgcagtcaacaatgg. Inner Right Sequence: aaaatccagaaaccgtggtg. Inner Primer PCR Length: 3224. Deletion Size: 950. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1526 |
C. elegans |
srd-44(ok1831) X. Show Description
F17A2.8. Homozygous. Outer Left Sequence: gtggacgactaccaatggct. Outer Right Sequence: tcagacatgggcgaatacaa. Inner Left Sequence: cttgatcagtcgctctcgtg. Inner Right Sequence: cgcaaccattttggagagac. Inner Primer PCR Length: 2335. Deletion Size: 2064. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1530 |
C. elegans |
sru-11(ok1835) IV. Show Description
Y45F10B.6. Homozygous. Outer Left Sequence: GCAAATTGGAGATACCCGAA. Outer Right Sequence: CAACGTGTTTTGATGAACGG. Inner Left Sequence: CCCAAATCCCGAGAAGTACA. Inner Right Sequence: AATTCGGCATTGGAAAACAG. Inner Primer PCR Length: 2781 bp. Deletion Size: 746 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1531 |
C. elegans |
T23F11.2(ok1836) III. Show Description
T23F11.2. Homozygous. Outer Left Sequence: cacctttctgtaggcgcttc. Outer Right Sequence: ccgtgtgtggttctcctttt. Inner Left Sequence: tcaagaaacccgaccaagtc. Inner Right Sequence: tcctagatggatggacggac. Inner Primer PCR Length: 2160. Deletion Size: 1356. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1540 |
C. elegans |
F14F3.2(ok1848) X. Show Description
F14F3.2 Homozygous. Outer Left Sequence: agcaaaaggaatgcgatgac. Outer Right Sequence: gttcccctatcatgccaaaa. Inner Left Sequence: ttctccgttgttttcccaag. Inner Right Sequence: acacgttccgaacctttcac. Inner Primer PCR Length: 3329. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1541 |
C. elegans |
pab-2(ok1851) X. Show Description
F18H3.3. Homozygous. Outer Left Sequence: TTTGTTCTGAGCTTGGGCTT. Outer Right Sequence: AATTTTCATGCCCATTCCAA. Inner Left Sequence: GGCCGAACAAATTACCATGT. Inner Right Sequence: AAATGTGGGCGAAAGATGAG. Inner Primer PCR Length: 3336 bp. Deletion Size: 1835 bp. Deletion left flank: AGATTTTTAAATTTTTTTGGGGTTTTTTGT. Deletion right flank: CCTTTGCTGTTTCCTTCATCGTCGGTGGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1544 |
C. elegans |
F11A5.4(ok1857) V. Show Description
F11A5.4. Homozygous. Outer Left Sequence: TGCTATGGAAGCGACTGTTG. Outer Right Sequence: TGCTTGCTTCATTTTTCACG. Inner Left Sequence: TTATCCCTTTTCCCCATTCC. Inner Right Sequence: ATACCTGCCATTGGACTTCG. Inner Primer PCR Length: 2332 bp. Deletion Size: 658 bp. Deletion left flank: CACGAGATTTATAGAAAGCTTAACTTTGGA. Deletion right flank: TATGCGCATGGTGGTCTTTGCCGAGTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1564 |
C. elegans |
F19H8.2(ok1898) II. Show Description
F19H8.2. Homozygous. Outer Left Sequence: TTCCCATTTTGCGATTTCTC. Outer Right Sequence: GGTCAAGTGTAAGCCTTGCG. Inner Left Sequence: TGCTGACAATGTGGAGCAGT. Inner Right Sequence: TCGTGTCATCGAGACCACTC. Inner Primer PCR Length: 2127 bp. Deletion Size: 738 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1594 |
C. elegans |
str-61&F14F8.8(ok1959) V. Show Description
F14F8.1, F14F8.8. Homozygous. Outer Left Sequence: TTTTCCCAACGTAGTGAGCC. Outer Right Sequence: GCCACAGGGTACGATAGCAT. Inner Left Sequence: AGGTTTTCAAAGTGCGTTCC. Inner Right Sequence: GCACAAAATCTCCCCCACTA. Inner Primer PCR Length: 2153 bp. Deletion Size: 1443 bp. Deletion left flank: AAAAAATTCTTAAAGATTCTGGAAGTTTTC. Deletion right flank: TATCCGGGCCGGCATCTATCTGCTTAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1600 |
C. elegans |
tub-1(ok1972) II. Show Description
F10B5.4. Homozygous. Outer Left Sequence: ATGATGATGGGACGGAACAT. Outer Right Sequence: TTTTGACACACCACACGCTT. Inner Left Sequence: TGGGACAAGGAAAATCGAAC. Inner Right Sequence: CGGCTTGTTTCCAATCATTT. Inner Primer PCR Length: 2809 bp. Deletion Size: 1676 bp. Deletion left flank: AATTGCATTGAAACCTTTAAAAAGAGTTTC. Deletion right flank: ATGCTCACAGAAACCGATGAGTTATCAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1627 |
C. elegans |
pll-1(ok2003) III. Show Description
K10F12.3. Homozygous. Outer Left Sequence: AAAACACCAATCAGGTTCGC. Outer Right Sequence: TGACCGGATAGAATTCGGAG. Inner Left Sequence: CACATGGCAAATTTAGGGCT. Inner Right Sequence: TTCAAGCAGACCATCTGCAC. Inner Primer PCR Length: 3277 bp. Deletion Size: 1120 bp. Deletion left flank: CAATCTCATGACAGTCGACGGCTTCACATC. Deletion right flank: TACCAATATATGTAATAAAGGACGATAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1649 |
C. elegans |
tbck-1(ok2038) II. Show Description
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1334 bp. Deletion left flank: CAATAAATACTACACAGATGATCAGGAGAA. Deletion right flank: TTGTCACGGAATCTCAACATTTTGTCTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1650 |
C. elegans |
F56F11.2(ok2039) III. Show Description
F56F11.2. Homozygous. Outer Left Sequence: CCGCCAAATCCTTATTTTCA. Outer Right Sequence: TTTTTCTGAATTTTTCGGCG. Inner Left Sequence: TGGAATCCAACAAAACACCA. Inner Right Sequence: TGAACGTGTCTGGGATGAAA. Inner Primer PCR Length: 2864 bp. Deletion Size: 1924 bp. Deletion left flank: GCAGCTGAAGAGCTCTACCGTGTATTTGAA. Deletion right flank: TGCTGACAAAGATGAAGATTTGGCTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1657 |
C. elegans |
R04F11.1(ok2047) V. Show Description
R04F11.1. Homozygous. Outer Left Sequence: AAATGGCCGATGTGATTGAT. Outer Right Sequence: TTCTCCGTGGGAATTTCAAG. Inner Left Sequence: GCCCATTGTTTTTCCATCTG. Inner Right Sequence: GCCAAAATTTCGAAACTGGA. Inner Primer PCR Length: 2447 bp. Deletion Size: 1294 bp. Deletion left flank: CATGGAACCAAACATGTGTATGTACGTTGC. Deletion right flank: CCTTAGGGCCTGGAACAGCTGAGAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1666 |
C. elegans |
tbck-1(ok2064) II. Show Description
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1935 bp. Deletion left flank: TGAAAACGGTGGAAGAAATGCGTGCAGCCG. Deletion right flank: GAAATGCATTCCCATTAATGATTGCTCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1687 |
C. elegans |
F13B6.1(ok2097) IV. Show Description
F13B6.1. Homozygous. Outer Left Sequence: CCAGAATGACCATTCCGTTC. Outer Right Sequence: GGTGAACAGGCAAATCCACT. Inner Left Sequence: TTCACACCTGCTCAAATTGC. Inner Right Sequence: CTGTGGATCCGACAATCCTT. Inner Primer PCR Length: 2315 bp. Deletion Size: 1059 bp. Deletion left flank: ATCAAGTACTTAATGGATTCGTGGGATTAC. Deletion right flank: CATAATTCTCTTGCCACGTATGTAGCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1704 |
C. elegans |
F14E5.4(ok2129) II. Show Description
F14E5.4. Homozygous. Outer Left Sequence: CTCGACGAATAGACCGATGC. Outer Right Sequence: TTTGGTCAGTTGGCATTTCA. Inner Left Sequence: CCTTTTTCCATCGAAACCAC. Inner Right Sequence: GCGTGCTTCAGAAAGGTGAT. Inner Primer PCR Length: 2170 bp. Deletion Size: 1766 bp. Deletion left flank: TTTTTCCATCGAAACCACAATTTATACTTG. Deletion right flank: TTTGCAAGATAAGCAGGATCGCTGAGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1719 |
C. elegans |
Y45F10D.13(ok2174) IV. Show Description
Y45F10D.13. Homozygous. Outer Left Sequence: CCGAAAAATCAGCCCACTAA. Outer Right Sequence: AATTGCCGTTTCACAAGTCC. Inner Left Sequence: AATTTCAGCCCATCATCTGC. Inner Right Sequence: TACATCTCGGATCCTTTCGG. Inner Primer PCR Length: 2960 bp. Deletion Size: 1110 bp. Deletion left flank: TAAAACCCCAAAATCATCATTGAAAATAAA. Deletion right flank: AAATTGATTACTGTTTCAAAAAGTTATTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1742 |
C. elegans |
ifb-1(ok2227) II. Show Description
F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1761 |
C. elegans |
F10F2.7(ok2264) III. Show Description
F10F2.7. Homozygous. Outer Left Sequence: CACATCCCTCCACCAATTCT. Outer Right Sequence: ATGTACCCGACTGAAGCCTG. Inner Left Sequence: ATTCCACACCCTGCTTTTTG. Inner Right Sequence: GACATGACTTGGCTTGGCTT. Inner Primer PCR Length: 2889 bp. Deletion Size: 912 bp. Deletion left flank: GATTAGATTTTGGGATCCGTTACGGCTAGT. Deletion right flank: CCTCTTGTCACATCAGAATCTGCGTACATG. Insertion Sequence: ATGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1787 |
C. elegans |
F56F11.5(ok2305) III. Show Description
F56F11.5. Homozygous. Outer Left Sequence: ACAAGCTGAAAATGCCCAAC. Outer Right Sequence: ATTGCCAAAAGTTCGATTGC. Inner Left Sequence: CAGAAATGTCCATGAAATTAACAAA. Inner Right Sequence: CAGGCTCCAGTTCGAAGTTT. Inner Primer PCR Length: 3054 bp. Deletion Size: 2283 bp. Deletion left flank: TAACTCGGCTATAGCCTATAGCCGAGTTTC. Deletion right flank: TAATAGTGCCACACTGTGCGTAATTATTAT. Insertion Sequence: TGAGATTTTTCAACTTTTCAAAAAATCTTATAAAATCTAGAATTTTTTTGAATTTTTTA AGCATGATATTTTGGTCTTTATGGCCCCATAGGCATGTTTTAAAGCAATTCCCACACAT AGTGTAGTCCATCTTTAAGTTTCTATGTATAAAAGTAATTTTTACCATTGCTTTTGCTT TGTAGGCAATCGCCATGATTTCCAGACTTCGTTGAGACTTTTCAATTATATAATCACGG TAAGACTTCGAACTATCTTTTCTTGATTGCGAAAACGAGGATGTGTAGTCAGCTTGCAA TGCTTCTATTGCTTGACGTGGTCCCTGTTCCCCATTCAATTGAAGGTGAGTTATTACCT TACACGCAAGTTGTTCAAGTTCTCTGCAAATTTACAATTGAAAACTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1820 |
C. elegans |
T25F10.6(ok2355) V. Show Description
T25F10.6. Homozygous. Outer Left Sequence: TGAATAGACGTGTCGTTGCC. Outer Right Sequence: CCTCATTCTGGGACGTGTTT. Inner Left Sequence: ATGTGGGTGGAGATGATGGT. Inner Right Sequence: TGACGTCGAAGACGAGTACG. Inner Primer PCR Length: 2512 bp. Deletion Size: 1021 bp. Deletion left flank: GACTCCCATCTGGTATGGAATCATTCCCTG. Deletion right flank: CTTGAATTGGGATAATTCCCTCGGATCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1848 |
C. elegans |
F19C6.4(ok2392) X. Show Description
F19C6.4. Homozygous. Outer Left Sequence: AACATTCTGTCCCCTATGCG. Outer Right Sequence: AACCGTACAAAAAGCATGGC. Inner Left Sequence: CAGCCATACAGCGTTTTGAA. Inner Right Sequence: GCCTACGGAGCAGAAGATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1030 bp. Deletion left flank: AAGCGATAATACTCCGTTTCATATACCAGT. Deletion right flank: ATATTAGAGGAGTTTTTTGGGTTGAAAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1888 |
C. elegans |
gly-10(ok2439) IV. Show Description
Y45F10D.3. Homozygous. Outer Left Sequence: CACACCAAGCCATACGTCAG. Outer Right Sequence: GCCCATTTTTGGAGATCAGA. Inner Left Sequence: TTTGGCCTCCTAACAAAACG. Inner Right Sequence: GTGCAAAAATCCTTTGCCAT. Inner Primer PCR Length: 3042 bp. Deletion Size: 1037 bp. Deletion left flank: CTTTTTGCAATTCAATTTTCAAATATTTGT. Deletion right flank: GAAATAGAGGCGGGGTGTAGTTTTGCAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|