More Fields
Strain Species Genotype
RB1402 C. elegans far-4(ok317) V. Show Description
F15B9.2 Homozygous. Outer Left Sequence: acggagaagaaccaagcaga. Outer Right Sequence: ttcaaacgtgtgatgaggga. Inner Left Sequence: ggcggttcaattcttccata. Inner Right Sequence: agagtggtggcattacctcg. Inner Primer PCR Length: 3041. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2334 C. elegans T03D8.6(ok3170) V. Show Description
T03D8.6. Homozygous. Outer Left Sequence: TTTTTCGACGATTGAGCCTT. Outer Right Sequence: TACGCGCAGAAGAATTTGTG. Inner Left Sequence: CAGTCATTCTATCAATAACCCATTG. Inner Right Sequence: CGAAAATTGGAGGGTAAGCA. Inner Primer PCR Length: 1214 bp. Deletion Size: 689 bp. Deletion left flank: CTCCGTGATAGAAAAGTTGAACTGGGTTTG. Deletion right flank: AATAAACACACAGCAATTAGCTGAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2335 C. elegans ivns-1(ok3171) X. Show Description
R09A8.3. Homozygous. Outer Left Sequence: CAAAGCAACACCAAAGCAAA. Outer Right Sequence: AAAAGACGTGGCGAAAGCTA. Inner Left Sequence: GCCATTGAGACGAAGGACTG. Inner Right Sequence: GCGTCTCGTCTTCCAAACAT. Inner Primer PCR Length: 1120 bp. Deletion Size: 643 bp. Deletion left flank: GCCATGCATTGGTTTTTGGATCGAATGCTT. Deletion right flank: CTCGTTGTCCGTAAGCTGAAGGCTAAGCAC. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2336 C. elegans F13H8.9(ok3172) II. Show Description
F13H8.9. Homozygous. Outer Left Sequence: TCTCAATCGGTGATGATGGA. Outer Right Sequence: AAGGCTGCTGATGCAATTCT. Inner Left Sequence: TCTTCTTAAGACGGGGAGCA. Inner Right Sequence: GAAGCAAGAAGTCATCTCGGA. Inner Primer PCR Length: 1198 bp. Deletion Size: 754 bp. Deletion left flank: CCACACTTGATGTATTTGGAAGTCTCTGGG. Deletion right flank: GAAGTTTTGAAACTTTCTTAGCATTTCTTA. Insertion Sequence: TGCTCGATATTTGTAGTGATAATATGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2337 C. elegans nas-18(ok3173) V. Show Description
K03B8.3. Homozygous. Outer Left Sequence: GGAGGAGCCAACTACCGAGT. Outer Right Sequence: CAGCCGAACAATAACTGCAA. Inner Left Sequence: TTGCTTTGATTCTTCATTCAGTAA. Inner Right Sequence: CCAATGGCAATCCAGTATCC. Inner Primer PCR Length: 1190 bp. Deletion Size: 724 bp. Deletion left flank: AAGTTCTATTATATTTTGAAGTAGTGAAAT. Deletion right flank: GCATAATTATGCAATTTTCAACCAATCTAC. Insertion Sequence: TGAAGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2338 C. elegans T23G5.6(ok3174) III. Show Description
T23G5.6. Homozygous. Outer Left Sequence: AGAAATGGATGGAAGCAACG. Outer Right Sequence: TAGGTGAGGGAAGTGCTGCT. Inner Left Sequence: AAACATTGCCCTGCAAAAAG. Inner Right Sequence: GCGATGCGATTTAGAGCAAT. Inner Primer PCR Length: 1281 bp. Deletion Size: 891 bp. Deletion left flank: ACGTGATAAAAAGGAACAAAATGGATATGG. Deletion right flank: GATGACAAAAATATTCTACATGAGCAAAAT. Insertion Sequence: ATATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2339 C. elegans F53H8.3(ok3175) X. Show Description
F53H8.3. Homozygous. Outer Left Sequence: GCGGTACCAGTTTCGTTCTT. Outer Right Sequence: CTCCTCCACGTCCAATCAAT. Inner Left Sequence: GCAATCAACCAGTACAAAAGTAGAA. Inner Right Sequence: GGAAATGGCGAAATTGAAAA. Inner Primer PCR Length: 1370 bp. Deletion Size: 622 bp. Deletion left flank: GAAAGGAGCAAGCACCTCACATGTTTGAGT. Deletion right flank: TGCAGAATTACGAAAATGTGAGTTTTGAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2341 C. elegans ubc-16(ok3177) I. Show Description
Y54E5B.4. Homozygous. Outer Left Sequence: AAGTTGTCGGAATTGGTTGG. Outer Right Sequence: TTGCGATTCGAAGAGAGCTT. Inner Left Sequence: CATTGTTCAATATGCACCCAA. Inner Right Sequence: TGGCCACAAAGAAGAAAAGG. Inner Primer PCR Length: 1138 bp. Deletion Size: 551 bp. Deletion left flank: TAAACACAATTTTTTTTCAGACGACAGTGT. Deletion right flank: GTGGGCGGCAAACGATTTTCCCGGAAAAAC. Insertion Sequence: ACAGTACCCACATTTGATAATATTTCGATACAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2342 C. elegans adm-2(ok3178) X. Show Description
C04A11.4. Homozygous. Outer Left Sequence: GGGAGATCAAATTTCGGTGA. Outer Right Sequence: CGATTGGCGGAAATTCTAAA. Inner Left Sequence: TCCAGATTCAAAAGAGACGTTG. Inner Right Sequence: CCACTGAGCGTAGTCCACCT. Inner Primer PCR Length: 1253 bp. Deletion Size: 989 bp. Deletion left flank: CTTGATGACGTGGGTGTTCCTATACAAAAA. Deletion right flank: TTTGTATAAAAATAGAGAAAAATATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2343 C. elegans F25E5.7(ok3179) V. Show Description
F25E5.7. Homozygous. Outer Left Sequence: TTCGGCAATATGCCCTTAAC. Outer Right Sequence: CGCGGCTGAAGACTTTAGTT. Inner Left Sequence: CCTTTCCTCCAACGAAGAATC. Inner Right Sequence: TGACATTGCATACCAGGAGAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 631 bp. Deletion left flank: TTTCAGTATTACGTTCAAAAAGATGGGAAA. Deletion right flank: GAACATGAACTGCAATGCGAATCCACAGAA. Insertion Sequence: AAAAAAACATTTTGATTAATTTCAGAATTTTGATAAATTTCAAAACATTTGATTAATTT CAGTATGACTCCGGAGGTAGTGCAATAAGCAACGTTTCCGGACAAAATACCGTTCTTGG AGTGTATGTAACAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2389 C. elegans ubc-16(ok3176) I. Show Description
Y54E5B.4. External left primer: AAGTTGTCGGAATTGGTTGG. External right primer: TTGCGATTCGAAGAGAGCTT. Internal left primer: CATTGTTCAATATGCACCCAA. Internal right primer: TGGCCACAAAGAAGAAAAGG. Internal WT amplicon: 1138 bp. Deletion size: 684 bp. Deletion left flank: AATTGATGACGCTATTTATGTGAGAACGTG. Deletion right flank: AACGGCACACTGCCGGAATTAAAATTTCCG. Insertion Sequence: TGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807