| OH18353 |
C. elegans |
pha-1(e2123) III; otEx8029. Show Description
otEx8029 [ceh-19(prom 2)::GFP + pha-1(+)]. Maintain 25C to select for array. Modified ceh-19 promoter fragment drives bright expression of GFP in MC L/R. There is also expression in an additional unidentified cell in the tail but this expression is much much dimmer and typically not visible under the dissecting scope. GFP expression in MC can be used to isolate MC by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH18398 |
C. elegans |
otIs669 him-5(e1490) V; unc-6(syb5064[unc-6::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH18410 |
C. elegans |
cone-1(syb5437[GFP::cone-1]) ceh-44(ot1294[*ot1015[ceh-44::GFP]]) III. Show Description
GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Normally broad, punctate expression of GFP::CEH-44 is not present. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18463 |
C. elegans |
unc-75(ot1351) I; ceh-44(ot1015[ceh-44::GFP]) III. Show Description
ot1351 is a CRISPR-engineered deletion of unc-75 gene rendering all 3 RNA recognition motifs null on unc-75; reduces pan-neuronal nuclear GFP expression fluorescence. GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18465 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH1849 |
C. elegans |
pha-1(e2123) III; otEx980. Show Description
otEx980 [dop-2::GFP + pha-1(+)].
|
|
| OH18508 |
C. elegans |
daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. Show Description
ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18559 |
C. elegans |
him-5(e1490) V; otIs810. Show Description
otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1].
|
|
| OH18594 |
C. briggsae |
Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18595 |
C. elegans |
unc-25(ot1372[unc-25::T2A::GFP::H2B] III. Show Description
Endogenous unc-25 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| OH18596 |
C. briggsae |
Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18619 |
C. elegans |
lim-6(ot1391[lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18624 |
C. tropicalis |
Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Ctr-lim-6 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18640 |
C. briggsae |
Cbr-lim-6(ot1393[Cbr-lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Cbr-lim-6 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18653 |
C. elegans |
ins-2(syb6543[ins-2::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH18671 |
C. tropicalis |
Ctr-unc-25(ot1397[Ctr-unc-25::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Ctr-unc-25 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18694 |
C. elegans |
col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. The reporter is linked to him-8(e1489) in the background. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18707 |
C. elegans |
otIs904 V. Show Description
otIs904 [ges-1p::ins-1::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6p18::tagRFP::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of INS-1 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18749 |
C. elegans |
cone-1(ot1409[*syb5437[GFP::con-1]) III. Show Description
syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18750 |
C. elegans |
cone-1(ot1410[*syb5437[GFP::con-1]) III. Show Description
syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18772 |
C. elegans |
ins-5(syb6245[ins-5::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH18821 |
C. elegans |
nlp-18(ot1421[nlp-18::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous nlp-18 locus using CRISPR/Cas9. The 15 first nucleotides of the standard SL2 sequence (immediately downstream of nlp-18 STOP) are missing but bright GFP fluorescence is clearly detectable. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18826 |
C. tropicalis |
Ctr-nlp-11(ot1422[Ctr-nlp-11::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-11 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18829 |
C. briggsae |
Cbr-nlp-3(ot1423[Cbr-nlp-3::SL2::GFP::H2B]) X. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-3 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18832 |
C. briggsae |
Cbr-nlp-18(ot1424[Cbr-nlp-18::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-18 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18853 |
C. tropicalis |
Ctr-ceh-32(ot1430[Ctr-ceh-32::GFP]) V. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Ctr-ceh-32 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18854 |
C. briggsae |
Cbr-ceh-32(ot1431[Cbr-ceh-32::GFP]) V. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Cbr-ceh-32 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18863 |
C. elegans |
unc-18(ot1432(unc-18::SL2::GFP::H2B)) X. Show Description
Endogenous reporter generated by the insertion of SL2::GFP::H2B into the endogenous unc-18 locus. Expression in intestine and nervous system. Reference: Boeglin M, et al. Genetics. 2023 Dec 6;225(4):iyad180. doi: 10.1093/genetics/iyad180. PMID: 37793339.
|
|
| OH18871 |
C. elegans |
ceh-44(ot1433[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1433 is a deletion removing exons 4-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18872 |
C. elegans |
ceh-44(ot1434[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18902 |
C. elegans |
degt-1(ot1445[degt-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous degt-1 locus directly before the DEGT-1 stop codon. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
|
|
| OH18948 |
C. elegans |
ceh-44(ot1447[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18961 |
C. tropicalis |
Ctr-nlp-3(ot1453[Ctr-nlp-3::SL2::GFP:H2B]) X. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-3 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19054 |
C. elegans |
pha-1 (e2123) III; otEx8199. Show Description
otEx8199 [sshk-1p::GFP + pha-1(+)]. Maintain at 25C. 370 bp of promoter directly upstream of sshk-1 fused to GFP. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH19089 |
C. tropicalis |
Ctr-nlp-18(ot1474[Ctr-nlp-18::SL2::GFP:H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-18 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19119 |
C. elegans |
cone-1(ot1485[*syb5500[cone-1::oxGFP]]) III. Show Description
syb5500 is an oxGFP tag inserted at the C-terminus of the endogenous cone-1 locus by CRISPR. ot1485 is an early stop codon introduced into exon 3 of the endogenously-tagged cone-1 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19120 |
C. elegans |
ceh-44(ot1486[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1468 is an early stop codon introduced into exon 3 of the endogenously-tagged ceh-44 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19125 |
C elegans |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. Show Description
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19186 |
C. elegans |
cone-1(ot1502[GFP::H2B::SL2::cone-1]) III. Show Description
GFP::H2B tag with SL2 inserted at N-terminus of endogenous cone-1 locus. Ubiquitous nuclear green at all stages (as early as 2-cell). GFP signal is very bright compared to C-terminal tag in OH19215. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19204 |
C elegans |
golg-4(ot1508[GFP::golg-4]) III. Show Description
GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19215 |
C. elegans |
cone-1(ot1514[cone-1::SL2::GFP::H2B]) III. Show Description
CRISPR reporter, substitution of SL2 for T2A. A broad nuclear expression begins around the Comma stage. Brighter expression with earlier initiation than T2A reporter. Expression becomes restricted to non-neuronal cells as animals mature to larval stages. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19219 |
C. elegans |
ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19278 |
C. elegans |
aex-4(ot1530[aex-4::SL2::gfp::his-44]) X. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-4 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19280 |
C. elegans |
aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19295 |
C. elegans |
unc-25(ot1536[unc-25b.1::T2A::GFP::H2B]) III; him-5(e1490) V. Show Description
CRISPR-engineered T2A::GFP::H2B insertion specifically tags isoform b.1 of the endogenous unc-25 locus. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| OH19333 |
C. elegans |
aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19575 |
C. elegans |
otIs927 V. Show Description
otIs927 [ges-1p::nlp-40::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6(prom18)::tagRFP-T::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of NLP-40 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19587 |
C. elegans |
php-3(syb1549[php-3::GFP]) III; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH1960 |
C. elegans |
pha-1(e2123) III; otEx1043. Show Description
otEx1043 [dop-1(prom2)::GFP + pha-1(+)].
|
|
| OH19735 |
C. elegans |
otIs937 V. Show Description
otIs937 [ceh-19(prom2)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. ceh-19(prom2) drives expression of daf-2(DN) specifically in the MC neurons in the pharyngeal nervous system. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
