Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC3285 C. elegans unc-62(gk3507) V/nT1 [qIs51] (IV;V). Show Description
T28F12.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3507 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAGCCAACACAAGAATCA. External right primer: TCGGTGTGCAAATCCAATTA. Internal left primer: ATCATCTTGCCGAAATCTGG. Internal right primer: TTTGACGTTCAGTTTGCTGG. Internal WT amplicon: 2229 bp. Deletion size: 628 bp. Deletion left flank: AGGCTTCCAATTTATTTTTTACACGCTTTT. Deletion right flank: GCGATAAATTTATCTGCAGGTCCTTTGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3327 C. elegans W03F9.1(gk3315) V/nT1 [qIs51] (IV;V). Show Description
W03F9.1. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3315 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACAACGAACAACCGAGG. External right primer: GCGAAGAAGATGTAGGCGTC. Internal left primer: ATCGGTTTCTCGAGTCCTCC. Internal right primer: AACGAGATTCAAAGCGGAGA. Internal WT amplicon: 2151 bp. Deletion size: 836 bp. Deletion left flank: ACTTCCAGATCAATCTCAGGGATCGACAGA. Deletion right flank: CACTTGTGAATTGCTTAATAATCTGCAAAA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3365 C. elegans pygo-1(gk3509) IV/nT1 [qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3509 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. WT internal amplicon: 2056 bp. Deletion size: approximately 600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3366 C. elegans Y62E10A.10(gk3369) IV/nT1 [qIs51] (IV;V). Show Description
Y62E10A.10. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3369 homozygotes (sterile, flaccid). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCTTTAAAGGCGCAGACGA. External right primer: GCAATGTGAACGTGGACAAC. Internal left primer: CACATTGACTTGATGGCTGG. Internal right primer: CCGATTTATTACTCGACCCG. Internal WT amplicon: 1660 bp. Deletion size: 617 bp. Deletion left flank: AGAGTGATTTTTTTTTAGACAAAAAAATTT. Deletion right flank: CCAGTTCCACCTGCAAGTATTTGTGGTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3371 C. elegans eat-6(ok1320) V/nT1 [qIs51] (IV;V). Show Description
B0365.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1320 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATCGGAATGAGATGGGAAA. External right primer: ACCTCAAGCAGGAGGTCAAA. Internal left primer: CGAATCAAGAAACGACGGAT. Internal right primer: CAAGAACGGACCAAATGCTT. Internal WT amplicon: 2957 bp. Deletion size: 780 bp. Deletion left flank: AAATTTATAATGAGATTTAATTGTCTTCTT. Deletion right flank: GACACATCAGATCCAGCAATACCCATAGCA. Insertion Sequence: GAAAAAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3461 C. elegans alh-5(gk3382) V/nT1[qIs51] (IV;V). Show Description
T08B1.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3382 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCACCTTTAATAACAATGGGGA. External right primer: CTCCAAGATCTCCCTCTCATGT. Internal left primer: CTTTCCCTACTCGCGCTACTT. Internal right primer: GTGTTGTTTGCCCAAGAATGT. Internal WT amplicon: 1350 bp. Deletion size: 349 bp. Deletion left flank: TTGACAATTGTAACATACTTTGGATCGAAA. Deletion right flank: ATATACCTACGCTACCGTTACAATTTCGCA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3475 C. elegans eelo-2(gk3391) IV/nT1[qIs51] (IV;V). Show Description
ZK550.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3391 homozygotes (sterile, lays no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACCGATAAGGGACTCGAAA. External right primer: CTCATCCACCACTTGGGTCT. Internal left primer: TTTCCTGTCGGAAAATTCAGTT. Internal right primer: CGACATTTCCATTTCATCTTGA. Internal WT amplicon: 1542 bp. Deletion size: 386 bp. Deletion left flank: TCATCAGAATTTTGATAAATACTTTTAAAA. Deletion right flank: TTTAATTTTTTTTAAAGAAAAATATTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3476 C. elegans hsp-1(ok1371) IV/nT1[qIs51] (IV;V). Show Description
F26D10.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1371 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCTCTCTCCCCCTTTTCGT. External right primer: AATAGCTTCTGCACCGCCTA. Internal left primer: GTTTTCATGCACGGAAAGGT. Internal right primer: CCTCAACCCCTGGCATAATA. Internal WT amplicon: 2566 bp. Deletion size: 1225 bp. Deletion left flank: ACGCAACGTTCTTATCTTCGATCTTGGAGG. Deletion right flank: CCTTCAACCTTAAGCAGACCATTGAGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3477 C. elegans pygo-1(gk3390) IV/nT1[qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3390 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. Internal WT amplicon: 2056 bp. Deletion size: 775 bp. Deletion left flank: CGGCGGAGCAAGAGTATTATTATTTCACGT. Deletion right flank: GCTGGAGATGATGGCGAATTCTTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WH556 C. elegans mrck-1(ok586) V/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok586 homozygotes (Lvl). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
WS5235 C. elegans ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
YHS25 C. elegans cdc-25.2(ok597) V/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok597 homozygotes (Emo, Ste). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, Kawasaki I, Shim Y. (2010) J Cell Sci 123:993-1000.
AMH50 C. elegans juIs76; bec-1(ok691) IV/nT1 [qIs51] (IV;V). Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II.  Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-pharyngeal GFP bec-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
AP36 C. elegans mep-1(ok421) IV/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok421 homozygotes, wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Received new stock 12/02.
CZ18637 C. elegans juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). Show Description
juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
FX11507 C. elegans rabs-5(tm2036) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested nT1 aneuploids, and non-GFP tm2036 homozygotes. tm2036 homozygotes are temperature sensitive lethal, and can be maintained as homozygotes at 15C. tm2036 homozygotes have endocytosis defects in oocytes and coelomocytes at 25C. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
JK2906 C. elegans mep-1(q660) IV/nT1 [qIs51] (IV;V). Show Description
M04B2.1 Throws Steriles and GFP(+) nT1 heterozygotes and dead eggs. The nT1 chromosome is apparently homozygous lethal since Vul worms are not seen. For some reason, crosses with this nT1[qIs51] chromosome generate an excess of male progeny. Do not distribute this strain; other labs should request it from the CGC.
JK2933 C. elegans gon-14(q12) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. q12 homozygotes have a white-patch phenotype. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3072 C. elegans gon-16(q568) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. q568(ts) homozygotes are sterile and can exhibit a white-patch phenotype. The severity of the white-patch increases with increasing temperature. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3073 C. elegans gon-15(q574) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. q574 homozygotes are sterile at all temperatures and exhibit a white-patch phenotype at 25C. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.
JK3140 C. elegans gon-1(e2551) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregate Gon worms which are GFP-. nT1[qIs51] homozygotes are inviable. Do not distribute this strain; other labs should request it from the CGC.
JK3297 C. elegans fbl-1(q750) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate q750 homozygotes which are GFP- sterile adults, and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
LG340 C. elegans skn-1(zu135) IV/nT1 [qIs51] (IV;V); geEx1. Show Description
geEx1 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Pick Rolling GFP+ and check for correct segregation of progeny to maintain. skn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Reference: Nature (2007) 447(7144):545-9.
LG348 C. elegans skn-1(zu135) IV/nT1 [qIs51] (IV;V); geIs9. Show Description
geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.
LG357 C. elegans skn-1(zu135) IV/nT1 [qIs51] (IV;V); geIs10. Show Description
geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.
MT13172 C. elegans mys-1(n4075) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.
MT14910 C. elegans pyp-1(n4599) IV/nT1 [qIs51] (IV;V). Show Description
n4599: C47E12.4 deletion from AA12F3.
MT15109 C. elegans lin-54(n3423) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
NB327 C. elegans ints-6(tm1615) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploids, and non-GFP dic-1 homozygotes. dic-1(tm1615) homozygotes arrest at the L3 larval stage. ints-6 previously known as dic-1.
NF963 C. elegans fbl-1(tk45) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. fbl-1(tk45) homozygotes are Dpy, Sterile and are Distal Tip migration defective.
OCF12 C. elegans lpin-1(ok2761) V/nT1 [qIs51] (IV;V). Show Description
Heterzygotes are wildtype and GFP+. lpin-1(ok2761) homozygotes die as L1 larvae. Homozygous nT1[qIs51] inviable.
RB1143 C. elegans F36D4.2(ok1128) V/nT1 [qIs51] (IV;V). Show Description
F36D4.2 Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1128 homozygotes. nT1[qIs51] homozygotes inviable. Outer Left Sequence: agtcatgaacagatccccca. Outer Right Sequence: attgcttggacgagaggaga. Inner Left Sequence: tgcttttattcgcacccagt. Inner Right Sequence: tggatctgcaagtccatctg. Inner Primer PCR Length: 2151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1217 C. elegans F25G6.2(ok1233) V/nT1 [qIs51] (IV;V). Show Description
F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1221 C. elegans his-74(ok1219) V/nT1 [qIs51] (IV;V). Show Description
W05B10.1 Heterozygotes are WT and GFP+. Outer Left Sequence: ttggcttatcggacagatcc. Outer Right Sequence: gtgagctcgtaatatccggc. Inner Left Sequence: aaaatgagaattgatcgcgg. Inner Right Sequence: accttgtgtgatttgcgatg. Inner Primer PCR Length: 2255. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1225 C. elegans pxf-1(ok1186) IV/nT1 [qIs51] (IV;V). Show Description
T14G10.2a Heterozygotes are WT and GFP+. Outer Left Sequence: ttgaaatttcgaagatcccg. Outer Right Sequence: catgcccgattatctccact. Inner Left Sequence: acccaccacatttcacgatt. Inner Right Sequence: ttcgattgaccctcatctcc. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1228 C. elegans arx-2(ok1269) V/nT1 [qIs51] (IV;V). Show Description
K07C5.1 Heterozygotes are WT and GFP+. Outer Left Sequence: tccaatttggcttcaacaca. Outer Right Sequence: catcgacttccgcgtatttt. Inner Left Sequence: tttgaatgagagtgggggag. Inner Right Sequence: ttttcaggcgaaatggattc. Inner Primer PCR Length: 2734. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1235 C. elegans T28C6.1(ok1264) IV/nT1 [qIs51] (IV;V). Show Description
T28C6.1 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms as the balancer may break down. ok1264 animals are homozygous viable. Outer Left Sequence: TCCCTGTTCCATTTTTGAGC. Outer Right Sequence: CATCACCTCTACCACCCCAT. Inner Left Sequence: AAGCCAAGAATTCGCAAAAA. Inner Right Sequence: CAACACCACCATGACCTGAA. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1246 C. elegans nxf-1(ok1281) V/nT1 [qIs51] (IV;V). Show Description
C15H11.3 Heterozygotes are WT and GFP+. ok1281 animals arrest as larvae. Outer Left Sequence: gagcttctgcaggacacaca. Outer Right Sequence: ctgcgaagatgggaaaagag. Inner Left Sequence: tgaaaagctcagtgacggtg. Inner Right Sequence: ctcgtctgcatttttgcgta. Inner Primer PCR Length: 3153. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1276 C. elegans sun-1(ok1282) V/nT1 [qIs51] (IV;V). Show Description
F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1277 C. elegans gcy-6(ok1293) V/nT1 [qIs51] (IV;V). Show Description
B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1280 C. elegans F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). Show Description
F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
TH112 C. elegans let-99(dd17) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation.
TH113 C. elegans let-99(dd18) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.
UV5 C. elegans sun-1(jf18) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are GFP+, and segregate non-GFP hermaphrodites which give only dead eggs. sun-1 is also called mtf-1.
VC1017 C. elegans tag-335(ok1455) IV/nT1 [qIs51] (IV;V). Show Description
C42C1.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1455 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1035 C. elegans rin-1(ok1511) V/nT1 [qIs51] (IV;V). Show Description
C48G7.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1511 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1090 C. elegans T10H9.3(ok1546) V/nT1 [qIs51] (IV;V). Show Description
T10H9.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1546 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1103 C. elegans Y49A3A.4(ok1547) V/nT1 [qIs51] (IV;V). Show Description
Y49A3A.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1547 homozygotes (early larval arrest). Lethal phenotype is suspicious, as deletion appears to affect only intron sequence. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1106 C. elegans sqd-1(ok1582) IV/nT1 [qIs51] (IV;V). Show Description
Y73B6BL.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1582 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1131 C. elegans rnp-1(ok1549) V/nT1 [qIs51] (IV;V). Show Description
ZK863.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1549 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807