Search Strains

F09C6.9. External left primer: ATTCCTCCTACTCCCTCCGA. External right primer: TAGGGCATTCTTTCATTGGC. Internal left primer: ATCTGTGTCTCTTCGCCCAT. Internal right primer: TCGATCAGCAAACCCTATCC. Internal WT amplicon: 2056 bp. Deletion size: 810 bp. Deletion left flank: TTTGAATACATTCTCGAAACTCTCTACCGC. Deletion right flank: ATAATCCGGACTGGAACGAAATGGACGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33E11.1. External left primer: GGACACACGTTCATAATGCG. External right primer: ACTTGACGGGAATGTTTTCG. Internal left primer: GGGCTCCACATCTTTGCTTA. Internal right primer: ATGTTATGAAGGTGGCCGAG. Internal WT amplicon: 2369 bp. Deletion size: 2143 bp. Deletion left flank: CGTTTGTCCCGTTGTCCCGTTTTTTGAGTG. Deletion right flank: GTGAAATTTGATGCAGATAAAATTTTGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 722 bp. Deletion left flank: TTTTCTCTGCTTCCCTGCGCGTCCTCAAAC. Deletion right flank: CATTCTCAAATAGAAACAGTTTTTTAACCA. Insertion Sequence: CATTTTCGTAGCGTTTTTCTCTTGCTTTACATCCTTTTCCAAACTTGCGATTCTATAAA TAAAAAATTTGAATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55D12.3. External left primer: AAAGGGGGAGAGAGAAACGA. External right primer: TTTGGTGCTGCTGAAAATTG. Internal left primer: AGAGACGCAGAGAAACGAGG. Internal right primer: TGACGATGGCAAATATGGAA. Internal WT amplicon: 1972 bp. Deletion size: 509 bp. Deletion left flank: TACGATAAGGTTCAGCTATGTATATCATTT. Deletion right flank: GTTTTCACAAATGCATTCTCGCTGGAATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1372 bp. Deletion left flank: CGTGGTATACCGTATACGTATACGGTAGAT. Deletion right flank: TTAATTTGAATTTTGTCAGCATTTTTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06A1. External left primer: CTGTGGGATTTGCAGGACTT. External right primer: CCGGATCGATTGCTAGAGAG. Internal left primer: ACAAACATTGACAGGAGCCC. Internal right primer: CCAATTTCTCGGGAATGAAA. Internal WT amplicon: 2095 bp. Deletion size: 552 bp. Deletion left flank: TTCTCCAATTTCCTGCCTATTTTGGCATAT. Deletion right flank: ATCAGAAATTTTACAATTTTCTTAATTTTT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 726 bp. Deletion left flank: ACAAAATTTAACCGATTTCAAAAATTATAA. Deletion right flank: TTGAACTCTATCGTATTCTGGGCGGTACTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31E8.3. External left primer: GCACAAGTTGTTGGGGAAGT. External right primer: TTCTTGTGCTTCATTCGTCG. Internal left primer: ATGAGAGGTCGAATTGTGCC. Internal right primer: CAAATTGAGAGCATTTGCCA. Internal WT amplicon: 1727 bp. Deletion size: 820 bp. Deletion left flank: ACTGAACATTACGAGACAATCAATTTCCAT. Deletion right flank: TGCAGCAGCAGCGTTTCCAATAGAACATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52C12.5. External left primer: ACCTCCTCCTCCGACAACTT. External right primer: GGTTCCTGCTGCTTTGACTC. Internal left primer: CCTCCCACCACTTTGTCATT. Internal right primer: GTAGGCATGGCAGCTCTTTC. Internal WT amplicon: 1787 bp. Deletion size: 965 bp. Deletion left flank: TTTCACTTGAATCATCATTTTTGCATTTTC. Deletion right flank: AGGAGCTGGTGGAACTTTAGAAATAAGCCA. Insertion Sequence: GAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1014.8. External left primer: TTGTTGGACGAGGTACTCCC. External right primer: AGGCTTCATGCAGCTTGTTT. Internal left primer: GGACGATTCATCGCGTTATT. Internal right primer: TTCAGAACAGCATTTCCGGT. Internal WT amplicon: 1855 bp. Deletion size: 1317 bp. Deletion left flank: ATACTAAAAACATAAATTTGATTATTAAAA. Deletion right flank: AGGAAACATGTTTTTATTTTATTTTTAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08B2.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk721 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTGGTTGAGACGATCCG. External right primer: AAGGTAACATCGCCATCGAC. Internal left primer: CGTGACATGAGATCAGGCAT. Internal right primer: GCTTGTCAAACCTCACGGAT. Internal WT amplicon: 2344 bp. Deletion size: 914 bp. Deletion left flank: GGAATTGTCTACAGTGGATGTATGAACACT. Deletion right flank: GGTTGCCATCAAATTCAAATTTCCAGGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M142.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk709 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTCTTCTATTGGC. External right primer: CGACACGCAACACCAATTAC. Internal left primer: AATCCACCGTAGTCACCGAG. Internal right primer: TCAGAGCATGTTTCCCAGTG. Internal WT amplicon: 2427 bp. Deletion size: 1019 bp. Deletion left flank: TAAATTTTTGTAGTTTTTTAGGGATTTTTT. Deletion right flank: TCACTTGTGGAGATGGTCGCCGCATCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57A10.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk735 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1634 bp. Deletion left flank: TGAGGTGTAGATCTTCTGATACGTGGACAG. Deletion right flank: AATTTGAGGGTGCTTATGATTTTTGGTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T15B12.1. External left primer: AAAAATTGCCAGAATCGTCG. External right primer: CAAAGGCGGTTTGTGAAAAT. Internal left primer: ATTGGCAATCTCCGTTCATC. Internal right primer: GTTAACAGCCAGATGCTCCC. Internal WT amplicon: 1544 bp. Deletion size: 622 bp. Deletion left flank: TGTGTTCTTTTGATTAATTGATATGCATTC. Deletion right flank: ACACTTCCAAATCGTCCAAATATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

VW02B12L.3. External left primer: AAACCATGTATGGGAACCGA. External right primer: GGAGTCGGCTTGTTTCAGAG. Internal left primer: AAACTTCTGCTCAAGAGGCG. Internal right primer: TAATGTGGAAATCGATGGCA. Internal WT amplicon: 1627 bp. Deletion size: 885 bp. Deletion left flank: CCACTGTTAACCATAGGAAATGCACTGATT. Deletion right flank: GACCGGTGGCTGCCGCTCCGCCAAAGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D1.4. External left primer: CAGATGGTGGAGGAACTGGT. External right primer: GGTTTTGACACCTCTCCGAA. Internal left primer: CGAATTCGAGATGCCAGATT. Internal right primer: TCACGCATTGTTCGAAAGTT. Internal WT amplicon: 1953 bp. Deletion size: 1329 bp. Deletion left flank: ATATTGAAGTCTTGTTTCTACTGTGTTTGA. Deletion right flank: ACAAAAGCAAAAATTACCCTTGAAGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1009.5. External left primer: TGAAAAATTGCGAACACCAA. External right primer: AGTCTGATTCTGGCGCTGTT. Internal left primer: TTTATGGAGAGATGGCCGAG. Internal right primer: GTCATTTCCATTGCTCCGAT. Internal WT amplicon: 1735 bp. Deletion size: 1182 bp. Deletion left flank: GAATCCCACTCTCTTCAGTTCTTTTTAATT. Deletion right flank: TTTCAAGAAATAGAGGAATCACAATAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D1.4. External left primer: CAGATGGTGGAGGAACTGGT. External right primer: GGTTTTGACACCTCTCCGAA. Internal left primer: CGAATTCGAGATGCCAGATT. Internal right primer: TCACGCATTGTTCGAAAGTT. Internal WT amplicon: 1953 bp. Deletion size: 1031 bp. Deletion left flank: TTCAAATAATAGCTTTATGAACTCTCTAAT. Deletion right flank: TTCAGAAAGTTGTTTTCGTGATGATGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57A10.6. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1323 bp. Deletion left flank: TTCTGATATCCCAGGAAGGCCTGAAAAATT. Deletion right flank: GTTAATTTTTTTAAAATCCCAGCTCAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02H5.1. External left primer: CTCTCAACTCCCCGTCCTTA. External right primer: TATCTCGACTGCCACGACAC. Internal left primer: GAACTATTCAAGCCCGGACA. Internal right primer: TGCGCTATTTCTCCTCCCTA. Internal WT amplicon: 1709 bp. Deletion size: 865 bp. Deletion left flank: AATTTTGCGGACGGTAAAAGTTCAAATTTT. Deletion right flank: ATTTGCCGGAAATTTTCAATTTCGGCAATT. Insertion Sequence: TTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04C3.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk760 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACCCATCATGTTACCGT. External right primer: GAAGCTCGTCGACCGTAGTC. Internal left primer: TCACGCATCCTTCTTCTCCT. Internal right primer: TTGCAGGGAGTTTCTATGGG. Internal WT amplicon: 1853 bp. Deletion size: 736 bp. Deletion left flank: TACTCGTCCATATACTGAGGTCGGAAGGAC. Deletion right flank: CGGACCTCCTGCATCTGAACTTTCGACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17E4.6. Maternal effect lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk787 homozygotes (fertile WT whose progeny arrest before reproducing). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTGTGTGAAGAGACGCAGA. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGAGCGCGTTTGCACTAATC. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2178 bp. Deletion size: 796 bp. Deletion left flank: AGAAGGAAGCTCCAATGACGAACATTCAAA. Deletion right flank: ACTGTTTTTGAAGAAACGTTTAAAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1081.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk719 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTACCTTCACCCCTCCAA. External right primer: CTATAACACGGGACCCCCTT. Internal left primer: GGTCCTTCCATTCCCATCTT. Internal right primer: GGCTGACATAACATCGCTCA. Internal WT amplicon: 2150 bp. Deletion size: 972 bp. Deletion left flank: ATGTTTCTAAAATTTATCTGCATTTTCATA. Deletion right flank: AAATATCCTGACTCACCTATTTAGTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03E6.4. External left primer: GAAGGGCAAATCGATGAAAA. External right primer: GATTCAACGGGTGCTTCTGT. Internal left primer: ATTGGATTCTTCCGGGAACT. Internal right primer: CTAACAGGTTCGAGGCGAAG. Internal WT amplicon: 1986 bp. Deletion size: 620 bp. Deletion left flank: TGTGCAAATAATCGTATTTTTCAAAAAAAG. Deletion right flank: TTCACATATTACAGAAATGTGCATCAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C12D12. External left primer: GCACTGTTGCTGTCCACACT. External right primer: CAGGATTGCAAGTTACGGGT. Internal left primer: AACTTTCTCGTGCTCCTCCA. Internal right primer: AAATGCGCTTTACCACCAAC. Internal WT amplicon: 2128 bp. Deletion size: 1665 bp. Deletion left flank: CTGACGAGGCGGCAGCAATTGGCGTTGTCT. Deletion right flank: ATCATTAGAATAATTTGTGCAAAATCTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34E10.7. External left primer: GTTGCGGACAACACACATTC. External right primer: CATGTTAATCGGTGACACGC. Internal left primer: ACGTACTCGATATCTCGCCG. Internal right primer: GTGGAACACCATTCCACACA. Internal WT amplicon: 2138 bp. Deletion size: 1176 bp. Deletion left flank: ACGAGGTTGGACCTGGAAAAGAGAGGGGAT. Deletion right flank: GTTCGTTGGGAAGGATGGAATGGTTTCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A8.7. External left primer: TTGGGCCTGAGACCTTATTG. External right primer: CCCCCTCAAACTCAAGCATA. Internal left primer: AGCCTGATCCGATTTCAATG. Internal right primer: TCAACTGTGGTCATTTCGGA. Internal WT amplicon: 2295 bp. Deletion size: 1704 bp. Deletion left flank: AATACCTCTACTAAAAATTTTTCATCACTG. Deletion right flank: AAAAATACATTTACTTAACATTCAGTTGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26D12.1. External left primer: CGGAGGAGGGAGTAAAGGAC. External right primer: CTTGAAGCCTACTCCGTTCG. Internal left primer: AAACAACCAACCAGCCAAAC. Internal right primer: TTAGAAACAGCAGCCGTCAA. Internal WT amplicon: 2256 bp. Deletion size: 952 bp. Deletion left flank: AGGTCCTTTCGAAGGACTACCTTTATATTC. Deletion right flank: TTCTTCCGGAAACTCCGCCCATAAATGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56A12.1. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1130 bp. Deletion left flank: AGGTGCCTCCCCCTCTTGGACTGTTGTACC. Deletion right flank: TTCCGCAAGTATCTGATATAGAACTTTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27C7.8. External left primer: TCCAAAATTCTCGTTCGGAG. External right primer: TCGACTTACCTCTGACCGCT. Internal left primer: TTCGGAATTTCTGTCCGAAG. Internal right primer: GTCGATGCACCAATGTTGAC. Internal WT amplicon: 2373 bp. Deletion size: 1439 bp. Deletion left flank: AAAAGGTTGGTAGTCGTCGGGAAATATATA. Deletion right flank: CCCACGAACCCACAATCACCATCCGCATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02H5.1. External left primer: CTCTCAACTCCCCGTCCTTA. External right primer: TATCTCGACTGCCACGACAC. Internal left primer: GAACTATTCAAGCCCGGACA. Internal right primer: TGCGCTATTTCTCCTCCCTA. Internal WT amplicon: 1709 bp. Deletion size: 638 bp. Deletion left flank: CAGGGCGTGTGCCATGTTTTTCAGGTGGGT. Deletion right flank: TTTCACGCTGTGGCAAGATGATTTCCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y5H2B.2. External left primer: CCCAGTGGAATGCAACTTTT. External right primer: TTGCATTCTCCTCGTAGCCT. Internal left primer: CGAGTGGAATTCTGAGAGCA. Internal right primer: CGAGACGGTAGCAGAAGACC. Internal WT amplicon: 2106 bp. Deletion size: 320 bp. Deletion left flank: TTTGCATTTATTTGCGTTTTTTTGGCTATA. Deletion right flank: TCAGTGTATTGACCAACCGGATGCCTGTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 579 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGT. Deletion right flank: TTGGGGGTAGATTTACTGAGGATATTGTAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01A1.1. External left primer: CTGTGGGATTTGCAGGACTT. External right primer: CCGGATCGATTGCTAGAGAG. Internal left primer: ACAAACATTGACAGGAGCCC. Internal right primer: CCAATTTCTCGGGAATGAAA. Internal WT amplicon: 2095 bp. Deletion size: 655 bp. Deletion left flank: CAGTGAGCAATTCACAACAGTTCTTCAATG. Deletion right flank: ATTAACGCTCCATAACGCTCGTACTTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y102A5C.18. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk790 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. NOTE: Balancer is prone to breaking down. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: TGTCGTTTCCCTTCCTTCAC. External right primer: TAGGCACAGCTTGAACCCTT. Internal left primer: TGGAGCGAAATTGAGGCTAT. Internal right primer: CAGAAAGCTAAGACCTGCGG. Internal WT amplicon: 1986 bp. Deletion size: 671 bp. Deletion left flank: GTGTCAAAAATGAAATTTTCATATGAAAAT. Deletion right flank: CAAAGTCAAGCTCATTGTCGAGCCCGAGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07A12.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk780 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGATTATGGGGTCGAATGG. External right primer: TGGAAAGATGGGGCAATTAG. Internal left primer: GGGAGCGAGAGAGAGACAAA. Internal right primer: GCTCCAGTGGGAAATTGAAA. Internal WT amplicon: 2317 bp. Deletion size: 1294 bp. Deletion left flank: AATGCATTGTCCAATCGCTGCTATGTATGC. Deletion right flank: AGAGCCAAAATGACCAACATTATTGACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk798 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1032 bp. Deletion left flank: CGAGGGAAATCAAATATCAGAACTTGAAAA. Deletion right flank: TATCATTCCAATGAATTCGAGACACTCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 668 bp. Deletion left flank: AGGAAGAGGACGGCCGGGAGGTGGATTGCA. Deletion right flank: ACGCTAAAATTGTCTGGAAAACTGCCAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807