Search Strains

More Fields
Strain Species Genotype Add
PS9381 C. elegans kcnl-2(sy1755) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: GAATGGAGCAATTGGAGATGATTCAACAGTTCCAT right flanking sequence: TGATGGACGAAAAAGATGATAACAGgttagttattc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATTCAACAGTTCCATTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9498 C. elegans ufd-3(sy1796) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: CTCATCATTCACTGAATTCGTATTTCTGTGATCGTGA. Right flanking sequence: ACGTGGTCAGGAACTTGTCGGAAGATTAATTGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTTCTGTGATCGTGAACG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9714 C. elegans haf-6(sy1907) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: ctctgcactggattcccattcggagcacATGGTAC. Right flanking sequence: AAGAGGCGTTGAATAATGTGATGAAGGGCCGAACTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCGGAGCACATGGTACAAG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
RA45 C. elegans rdIs2 V. Show Description
rdIs2 [ehn-3a::GFP + rol-6(su1006)] V. Rollers. The ehn-3a::GFP reporter (pRA230) contains 3,003 bp upstream of the ehn-3a translational start and the first two exons of ehn-3a. GFP expression in Z1 and Z4 during embryogenesis and early larval development. Reference: Welchman DP, Mathies LD, Ahringer J. (2007) Dev Biol. 305(1): 347-57.
RM1613 C. elegans snt-1(md290) II. Show Description
snt-1(md290) is a 3264-bp deletion removing all coding sequence in exons 3-8. Breakpoints: ttatagatttcaattaaatagtaaacaaaa / / aatctctctttgttttcactcttccaacat. Reference: Nonet ML, et al. Cell. 1993 Jul 2;73(7):1291-305.
SP2628 C. elegans unc-36(e251) III; mnIs61. Show Description
mnIs61 [dpy-7p::unc-52(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SP2642 C. elegans unc-36(e251) III; mnIs63. Show Description
mnIs63 [dpy-7p::unc-52(e669)(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SP2678 C. elegans unc-36(e251) III; mnIs64. Show Description
mnIs64 [myo-3p::unc-52(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SYS1008 C. elegans ujIs113 II; M03D4.4(dev248) IV. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. M03D4.4(dev248) is a large CRISPR/Cas9-engineered deletion removing exons 4-6 and most of exon 7. Forward: 5'-CAATAGTCTATCTTCTAATAGTATTGGTTCCA-3' , Reverse: 5'-TGCAAGACAATAATTTGTCGGACTA-3'.
TG1568 C. elegans fan-1(tm423) IV. Show Description
411 bp deletion removes exons 6-8. Homozygotes are viable, but are hypersensitive to DNA crosslinking.
TN145 C. elegans him-8(e1489) IV; adt-1(cn30) X. Show Description
Morphological changes in the rays, especially transformation of ray 6 into a thickened shape. Appearance of abnormal protuberances around rays. Closed structure of the fan. Impaired mating ability. Exons 8-10 of the adt-1 gene, encoding most of the metalloproteinase domain of ADT-1, are deleted in adt-1(cn30).
VF3 C. elegans hmt-1(gk161) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 2,149 bp deletion encompasses exons 5, 6 & 7; introduces premature stop codon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
XE3354 C. elegans unc-40(wp221) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. wp221 is a CRISPR-engineered deletion of unc-40 exon 14.5 near the splice sites of exons 14 and 15. mec-4p::GFP is expressed in touch neurons. Reference: Weinreb A, et al. Nat Commun. 2025 May 16;16:4508. doi: 10.1038/s41467-025-58293-5. PMID: 40379606.
XR1 C. elegans abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
ZE1 C. elegans F53B2.5(ok226) Show Description
Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.
ZG31 C. elegans hif-1(ia4) V. Show Description
Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.