Search Strains

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1543 [LoxP::tetO 7X::(delta)mec-7p::(delta)mec-7p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1548 [LoxP::mec-4p::rtetR-L-QF::FRT3] IV. RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet ON mec-4p rtetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1554 [LoxP::mec-4p::QF2::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF2 driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1519 [LoxP::tetO 7X:: (delta)pes10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSI1560 [LoxP::mec-4p::tetR-L-QF::FRT3] IV.RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet OFF mec-4p tetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.

jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.

jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3’ rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.

jsSi1691 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3' rpl-28p::FRT::GFP::his-58::FRT3] II. Single component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.

jsSi1726 [loxP myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] II. Single component rapid RMCE landing site on Chromosome II adjacent to ttTi5605. Created from jsSi1579 (and jsSi1706) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1727 [mosL::loxP::myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3::mosR] I. Single component rapid RMCE landing site on Chromosome I at jsTi1453. Created from jsTi1453 (and jsSi1710) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1815 [loxP::mex-5p::FLP::sl2::mNeonGreen + rpl-28p::FRT::GFP::his-58 3' FRT3] V. Single component RMCE landing site on Chromosome V adjacent to oxTi365. Created using CRISPR/cas9 with SEC selection and heat shock excision. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1944 [loxP::mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1962 [mosL::loxP::FRT + myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1978 [loxP::FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1986 [loxP + myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP::D5 glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1987 [loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1988 [loxP + cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1985 [loxP + myo-2p::FRT::nls::CyOFP myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1949 [loxP + myo-2p::FRT::nls::mNG myo-2 3' + <{rps-0p HygR unc-54 3'} ori <{Amp} <{mex-5p nls-Cre tbb-2 3'} + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1963 [loxP + FRT::myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi2029 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + mex-5p::nls::Cre::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

Bacteria. RNAi-compatible OP50 strain. Slow growing. When growing this strain, pick single colonies for liquid culture (at least 20 hrs) from a freshly streaked tetracycline LB plate. Do not include tetracycline in liquid culture, as Tet in liquid culture can have long lasting effects on worm lifespan. The authors recommend using standard PEG transformation method to make competent OP50(xu363) cells, but other ways to make competent cells will also likely work for OP50(xu363). Reference: Xiao R, et al. Cell Rep. 2015 May 19;11(7):1123-33.

nsEx992 [vap-1::hsf-1 + hsp::FRT-GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in amphid sheath cells and occasionally gut following heat shock. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.

Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

ddIs97 [F47G4.6::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs106 [hmg-3::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs129 [klp-4::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs145 [klp-7::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs193 [rabs-5::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs254 [ctbp-1::2xTY1::GFP:: FRT::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. GFP::FLPon(FRT) tag inserted into endogenous rab-10 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/).

LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.

hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC).

hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite.

hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035

bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. Ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi346 [loxN::lin-31p::FLP]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in VPCs. High levels of TIR1(F79G) expression in vulval precursor cells by lin-31p::FLP with co-expression of CDK activity sensor. bmdSi297 contains the ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi362 [loxN::rpl-28p::FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in neurons. High levels of TIR1(F79G) expression in neurons by rgef-1p::FLP with co-expression of membrane markers. bmdSi362 contains the ubiquitous rpl-28 promoter driving expression of FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2 construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

jsSi1623 [loxP::mex-5p::phiC31::SL2::mNG::glh-2 3’ FRT3] IV. Transgene expresses phiC31 and mNG in the germline, facilitates integration of extrachromosomal arrays at high efficiency. Reference: Nonet ML. bioRxiv 2024.03.01.583017.

jsSi1784 [mex-5p::FLP D5::SL2::mNeonGreen::glh-2 3' UTR + Cbr-unc-119(+) attL rps-7 3' mex-5p::phiC31::glh-2 3' FRT3] IV. Inserted at cxTi10882 on IV. Transgene expressing FLP and phiC31 recombinases and mNG in the germline for performing Recombination Mediated Insertion (RMI) transgenesis and Recombination Mediated Homolog Exchange (RMHE). Reference: Nonet ML. bioRxiv 2024.03.01.583017.

jsSi1822 [loxP mex-5p phiC31 sl2 mNG glh-2 3’ FRT3] II. Insertion is on Chr II at 0.77 mu adjacent to ttTi5605. Him. Strain expressing phiC31 and mNG in the germline for performing phiC31 mediated recombination. Reference: Nonet ML. bioRxiv 2024.03.01.583017.

jsSi2615 [loxP attP rps-7 3' FRT3] II. jsSi1784 [mex-5p::FLP D5::SL2::mNeonGreen::glh-2 3' UTR + Cbr-unc-119(+) attL rps-7 3' mex-5p::phiC31::glh-2 3' FRT3] IV. Expressses phiC31 and FLP recombinases and mNG in germline. Strain contains an unmarked phiC31 attP landing site on Chr II. Reference: Nonet ML. bioRxiv 2024.03.01.583017.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.