| OH14768 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6871. Show Description
otEx6871 [srr-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14769 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6872. Show Description
otEx6872 [srr-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14770 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6873. Show Description
otEx6873 [srr-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14771 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6874. Show Description
otEx6874 [srr-8p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14772 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6875. Show Description
otEx6875 [srr-9p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14773 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6876. Show Description
otEx6876 [srr-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14838 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6909. Show Description
otEx6909 [srz-56p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14840 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6911. Show Description
otEx6911 [srz-104p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14861 |
C. elegans |
lite-1(ce314) X; otIs644. Show Description
otIs644 [tdc-1::ChR2::YFP]. Reporter contains 4.4 kb of tdc-1 promoter fused to ChR2::YFP; can be used for optogenetic stimulation of tyraminergic and octopaminergic neurons.
|
|
| OH14926 |
C. elegans |
bnc-1(ot721) vsIs33 V. Show Description
vsIs33 [dop-3::RFP] V. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
|
|
| OH14953 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6946. Show Description
otEx6946 [sri-50p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14954 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6947. Show Description
otEx6947 [srz-24p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14956 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6949. Show Description
otEx6949 [srz-66p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14958 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6951. Show Description
otEx6951 [srh-74p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14962 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6955. Show Description
otEx6955 [srz-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14964 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6957. Show Description
otEx6957 [sri-45p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14966 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6959. Show Description
otEx6959 [srz-61p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14969 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6961. Show Description
otEx6962 [srx-44p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14970 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6963. Show Description
otEx6963 [srj-23p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14971 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6964. Show Description
otEx6964 [srbc-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14973 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6966. Show Description
otEx6966 [srw-119p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH14975 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6968. Show Description
otEx6968 [srj-13p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH15039 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otIs625. Show Description
otIs625 [cat-1(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Fosmid-based cat-1 reporter marks aminergic neurons.
|
|
| OH15097 |
C. elegans |
him-5(e1490) V; otIs541. Show Description
otIs541 [lim-6(intron4)::wCherry]. Red fluorescent reporter labels DVB neuron in males and hermaphrodites; also labels AVL, PVT, and 2 additional dim neurons in head. Hart MP & Hobert O. Nature. 2018; 553:165-170. PMID: 29323291.
|
|
| OH15128 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx7020. Show Description
otEx7020 [srg-64p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH15134 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx7026. Show Description
otEx7026 [srn-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH15205 |
C. elegans |
otEx7057. Show Description
Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15224 |
C. elegans |
pha-1(e2123) III; otEx7074. Show Description
otEx7074 [inx-20(fosmid WRM066cA02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15225 |
C. elegans |
pha-1(e2123) III; otEx7075. Show Description
otEx7075 [inx-18a(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15227 |
C. elegans |
unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154.
|
|
| OH15242 |
C. elegans |
pha-1(e2123) III; otEx7090. Show Description
otEx7090 [inx-11(fosmid WRM0621cA09)::SL2::NLS::YFP::H2B + pha-1(+) + unc-122::GFP]. Maintain at 25C or pick GFP+ to retain array.
|
|
| OH15244 |
C. elegans |
pha-1(e2123) III; otEx7092. Show Description
otEx7092 [inx-18b(fosmid WRM0629cH03)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15262 |
C. elegans |
otIs669 V. Show Description
otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15263 |
C. elegans |
otIs670 V. Show Description
otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15265 |
C. elegans |
otIs672. Show Description
otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. Bright panneuronal nuclear GCaMP6s expression. Reference: Yemini E, et al. https://www.biorxiv.org/content/10.1101/676312v1
|
|
| OH15271 |
C. elegans |
pha-1(e2123) III; otEx7102. Show Description
otEx7102 [inx-5(fosmid WRM0625cD05)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15272 |
C. elegans |
pha-1(e2123) III; otEx7103. Show Description
otEx7103 [inx-14(fosmid WRM0626aA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15273 |
C. elegans |
pha-1(e2123) III; otEx7104. Show Description
otEx7104 [inx-13(fosmid WRM0621dC07)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15274 |
C. elegans |
pha-1(e2123) III; otEx7105. Show Description
otEx7105 [inx-16(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15275 |
C. elegans |
pha-1(e2123) III; otEx7106. Show Description
otEx7106 [unc-7(fosmid WRM0627bH02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15276 |
C. elegans |
pha-1(e2123) III; otEx7107. Show Description
otEx7107 [inx-1b(fosmid WRM0672aB09)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15278 |
C. elegans |
pha-1(e2123) III; otEx7109. Show Description
otEx7109 [unc-9(fosmid WRM0611aH10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15281 |
C. elegans |
pha-1(e2123) III; otEx7112. Show Description
otEx7112 [che-7(fosmid WRM0640dF02)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15282 |
C. elegans |
pha-1(e2123) III; otEx7113. Show Description
otEx7113 [inx-12(fosmid WRM0621dC07)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15285 |
C. elegans |
pha-1(e2123) III; otEx7116. Show Description
otEx7116 [inx-1a(fosmid WRM0672aB09f)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15288 |
C. elegans |
pha-1(e2123) III; otEx7119. Show Description
otEx7119 [inx-10a(fosmid WRM0628bH12):SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15291 |
C. elegans |
pha-1(e2123) III; otEx7121. Show Description
otEx7121 [inx-3(fosmid WRM0636dA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
| OH15363 |
C. elegans |
otIs669 him-5(e1490) V Show Description
High incidence of males (Him). otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Not known where otIs669 maps relative to him-5. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15430 |
C. elegans |
pha-1(e2123) III; otIs669 V. Show Description
Maintain at 15C. Temperature-sensitive. Slow growing. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15439 |
C. elegans |
ceh-34(ot903[ceh-34::mNG::3xFLAG::AID*]) V. Show Description
CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID* tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
