| VC40999 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41000 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41001 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41002 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41003 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41004 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41005 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41006 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41007 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41008 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41009 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41010 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41011 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41013 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41014 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41015 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41016 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41017 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41018 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41019 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41020 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41021 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41022 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41023 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41024 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41025 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41026 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41028 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41029 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41030 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41031 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41032 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC41033 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC418 |
C. elegans |
him-3(gk149) IV/nT1 [qIs51] (IV;V). Show Description
ZK381.1. Homozygous viable deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP gk149 homozygotes (strongly Him, with small broods and many arrested embryos). nT1[qIs51] homozygotes inviable. Pick GFP WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VF14 |
C. elegans |
arIs37 I; unc-119(ed3) hmt-1(gk161) III; cdIs32. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. Hypersensitive to cadmium. Lacks coelomocytes and accumulates GFP in pseudocoelome. Maintain under normal conditions. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF3 |
C. elegans |
hmt-1(gk161) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 2,149 bp deletion encompasses exons 5, 6 & 7; introduces premature stop codon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF8 |
C. elegans |
hmt-1(gk155) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 416 bp deletion encompasses exon 1; in-frame Met present in second exon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF9 |
C. elegans |
pcs-1(tm1748) II; hmt-1(gk161) III. Show Description
Acute hypersensitivity to heavy metals (Cd, As, Cu). Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| XT3 |
C. elegans |
cln-3.3(gk118) V. Show Description
Derived from VC146. Made as model for Batten disease. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT4 |
C. elegans |
cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT6 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) V. Show Description
Made as model for Batten disease. Derived from XT2 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT7 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Decreased brood size, mild life-span reduction. Made as model for Batten disease. Derived from XT2 and XT4. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| ZM8969 |
C.elegans |
flp-14(gk1055) III. Show Description
Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
| ZM9474 |
C elegans |
flp-14(gk1055) III; hpSi38. Show Description
hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
| ZM9519 |
C. elegans |
flp-14(gk1055) III; hpSi38; hpIs201. Show Description
hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
| ZT73 |
C. elegans |
coh-4(tm1857) coh-3(gk112)/tmC16 [unc-60(tmIs1210)] coh-3(gk112) V. Show Description
Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|