| VF2 |
C. elegans |
pcs-1(tm1748) II. Show Description
Hypersensitive to cadmium. Maintain under normal conditions. 588 bp deletion + 3 bp insertion [36918/36919 - AAA - 37506/37507]. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF9 |
C. elegans |
pcs-1(tm1748) II; hmt-1(gk161) III. Show Description
Acute hypersensitivity to heavy metals (Cd, As, Cu). Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| OCF116 |
C. elegans |
unc-119(ed3) his-72(erb77[his-72::linker::mTurquoise2]) III; atln-1(ocf101[atln-1::3xFLAG::AID*]) IV; ojIs23. Show Description
ojIs23 [pie-1p::GFP::spcs-1 + unc-119(+)]. mTurqoise2 tag with linker sequence inserted into C-terminus of endogenous his-72 locus. GFP::AID* degron tag inserted at C-terminus of endogenous atln-1 locus. ocf101 guide: CCGCTGATGGACTCAGAAAA. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
|
|
| OCF127 |
C. elegans |
bsSi15 I; unc-119(ed3) III; ojIs23. Show Description
bsSi15 [spd-2p::spd-2::mCherry::spd-2 3'UTR + unc-119(+)] I. ojIs23 [pie-1p::GFP::spcs-1 + unc-119(+)]. Reference: Maheshwari R, et al. Curr Biol. 2023 Mar 13;33(5):791-806.e7. doi: 10.1016/j.cub.2022.12.059. PMID: 36693370.
|
|
| RG5021 |
C. elegans |
spcs-1(gk5510[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])//hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5510 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4435 and CGC92. gk5510 is a 735 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAAAACCGCTCCAGCGCGGTACATTTCTGT; Right flanking sequence: GTAAAATAGAGATTTTCCATGGAGCGCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4435 |
C. elegans |
spcs-1(gk5510[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5021 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 735 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAAAACCGCTCCAGCGCGGTACATTTCTGT; Right flanking sequence: GTAAAATAGAGATTTTCCATGGAGCGCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| WH327 |
C. elegans |
unc-119(ed3) III; ojIs23. Show Description
ojIs23 [pie-1p::GFP::spcs-1 + unc-119(+)].
|
|
