Search Strains

Decreased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

adEx1204 [rol-6(d) + eat-4::lacZ]. Medium transmission.

adEx1241 [eat-4(+) + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv and Eat. n765 is temperature-sensitive.

adEx1242 [eat-4(+) + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv and Eat. n765 is temperature sensitive.

adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive.

adEx1262 [gcy-5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1266 [gcy-12::GFP + lin-15(+)]. Maintain by picking non-Muv. Very weak GFP signal. n765 is temperature-sensitive.

adEx1267 [gcy-8::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1269 [odr-1::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1276 [gcy-?::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1288 [gcy-7::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1290 [gcy-33::GFP + lin-15(+)]. Maintain by picking non-Muv. gcy-33::GFP in BAG. n765 is temperature-sensitive.

adEx1292 [R01E6.1_8k::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1295 [gcy-32::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1296 [gcy-32::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1297 [gcy-6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1299 [avr-15::GFP + rol-6(su1006)]. GFP expression in pharyngeal muscle and some extrapharyngeal neurons. Maintain by picking Rollers.

raEx129 [T05G5.1p::W09C5.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Psoralen integration of oxEx129 [unc-49Bp(long)::GFP + lin-15(+)]. Dorsal and ventral.

quEx128 [npr-9::GFP + rol-6(su1006)]. Maintain by picking Rollers. ZK455.3 is npr-9 and is expressed in AIB neuron.

lstEx122 [unc-119p::pdfr-1c::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1c isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

vs163 is a 169 bp deletion removing exon 2 and causing frameshift.

lucEx1207 [myo-3p::YFP]. Pick YFP+ to maintian. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

mirEx123 [myo-3p::TeNL::unc-54 3' UTR]. Maintain strain by picking animals with blue fluorescence. bus-17(br2) has mutant defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in muscles. Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.

Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.

wdEx1201 [spe-27p::tagRFP + pha-1(+)]. Maintain at 25C to select for array. RMF neurons are labeled with TagRFP. Can be used to isolate RMF by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

qyEx121 [F55C7.7d::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx120 [F55C7.7c::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx122 [F55C7.7e::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx123 [K07D4.7a::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx124 [pix-1::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx125 [R02F2.2::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx126 [T19E10.1::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx127 [ced-5::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx128 [F22G12.5::GFP + unc-119(+)]. Maintain by picking non-Unc.

otEx5024 [lsy-6(fosmid) + ttx-3::mCherry]. Maintain otEx5024 by picking animals with mCherry in the AIY neurons. otIs3 [gcy-7p::GFP + lin-15(+)] V. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.

ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. otIs151 [ceh-36p::RFP + rol-6(su1006)]. Rollers. Both ASEL and ASER show GFP expression from ntIs1.

otIs3 [gcy-7::GFP + lin-15(+)]. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.

ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. GFP expression appears in ASER in adult animals.

oyIs14 [sra-6::GFP + lin-15(+)]. otEx1254 [egl-15p::egl-15(5B) genomic hybrid + ceh-22p::GFP + pBS]. otEx1254 rescues the lethal phenotype of egl-15(n1456).

oyIs14 [sra-6::GFP + lin-15(+)]. otEx1267 [pTB71=egl-15p::egl-15(5B) genomic hybrid + ceh-22p::GFP + pBS]. otEx1267 rescues the lethal phenotype of egl-15(n1456).

oyIs14 [sra-6::GFP + lin-15(+)]. otEx1270 [dpy-7p::egl-15(5A)cDNA + ceh-22p::GFP + pBS]. Maintain by picking worms with GFP expression in their pharynx.

otIs3 [gcy-7::GFP + lin-15(+)]. che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. otIs3 was derived by integration of adEx1288 [gcy-7::GFP + lin-15(+)]. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.