Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1181 C. elegans gld-2(ok1117) I. Show Description
ZC308.1 Homozygous. Outer Left Sequence: TGTTTGAATGGGGTTTCTCC. Outer Right Sequence: ACTTCCTGGTCGTTGTGGTC. Inner Left Sequence: ACAGGTGGTCAACCCATGAT. Inner Right Sequence: ACGAAGACTAGCACACGCAA. Inner Primer PCR Length: 3342. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1182 C. elegans tba-1(ok1123) I. Show Description
F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence:cagcccgactttcatttctc . Inner Primer PCR Length: 2176. Estimated Deletion Size: about 1100 bp. Received new stock 11/04/04. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1183 C. elegans prom-1(ok1140) I. Show Description
F26H9.1 Homozygous. Outer Left Sequence: gatcgaagccaaagaacgaa. Outer Right Sequence: tgaggggacattcacacgta. Inner Left Sequence: tgggtactgtagtgggggtg. Inner Right Sequence: aaaggaggaacaaaatgggg. Inner Primer PCR Length: 2240. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1184 C. elegans Y82E9BR.14(ok1230) II. Show Description
Y82E9BR.14 Homozygous. Outer Left Sequence: ggggttcaggagggtaaaaa. Outer Right Sequence: atttgaagaatttcgcgtgc. Inner Left Sequence: cacgttaagccggaaattgt. Inner Right Sequence: gcgtcacggctagatttttc. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1185 C. elegans tba-1(ok1135) I. Show Description
F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1186 C. elegans unc-89(ok1116) I. Show Description
C24G7.5 Homozygous. Outer Left Sequence: GTCCACGTCAAGAGCACTCA. Outer Right Sequence: GACTCGAGCTCTTCGCTGAT. Inner Left Sequence: GAAAACCTGGATTCTTGCCA. Inner Right Sequence: GAACTGGCGACTTTTTGAGC. Inner Primer PCR Length: 3199. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1187 C. elegans tbx-41(ok1231) X. Show Description
T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1188 C. elegans F23B12.6(ok1232) V. Show Description
F23B12.6 Homozygous. Outer Left Sequence: AGCATTTGGATATTGGCGAG. Outer Right Sequence: AGTGAACGGGAGATTTGTGC. Inner Left Sequence: TTGTGTGAAACCGATGTTGG. Inner Right Sequence: AGCCATCTCATCCTTTCCCT. Inner Primer PCR Length: 2975. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1189 C. elegans chs-1(ok1120) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T25G3.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Segregates very rare homozygous hT2 glowing animals. Outer Left Sequence: tgtggctgtgttgcaaagat. Outer Right Sequence: tggagaagcattccgagagt. Inner Left Sequence: atttgcacttcagctggctt. Inner Right Sequence: ggttcatcggtttcctcgta. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1190 C. elegans amx-2(ok1235) I. Show Description
B0019.1 Homozygous. Outer Left Sequence: ttggcggaaatttgaaagtc. Outer Right Sequence: tccaacggacacccaattat. Inner Left Sequence: cagcctcaaccaccttttgt. Inner Right Sequence: tctcagcaaatggacactgc. Inner Primer PCR Length: 2803. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1191 C. elegans C16A11.4(ok1236) II. Show Description
C16A11.4 Homozygous. Outer Left Sequence: ctaccaagaaaatcgccgaa. Outer Right Sequence: gtggaggcaccgtaacttgt. Inner Left Sequence: catagaaattccgccgaaaa. Inner Right Sequence: tctcgacgcgaaaaggttat. Inner Primer PCR Length: 2747. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1192 C. elegans C24G7.4(ok1237) I. Show Description
C24G7.4 Homozygous. Outer Left Sequence: ccctttttgacgtgcattct. Outer Right Sequence: ggagcccataaacaccaaaa. Inner Left Sequence: acaagcagtttgccaatcaa. Inner Right Sequence: ttgttttgaagcgaaaaccc. Inner Primer PCR Length: 3185. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1193 C. elegans F44D12.9(ok1238) IV. Show Description
F44D12.9 Homozygous. Outer Left Sequence: AGCCAAGATTTGGGCCTACT. Outer Right Sequence: TGCACCATATCCGTGTGACT. Inner Left Sequence: ACATGCTTGTTTTTGGGGAA. Inner Right Sequence: AATGGGTGTACTGGCGACTC. Inner Primer PCR Length: 2230. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1194 C. elegans grk-1(ok1239) X. Show Description
F19C6.1 Homozygous. Outer Left Sequence: AGGAATGAATCGGAGACGTG. Outer Right Sequence: TTGCCACAGCTTCGTAATTG. Inner Left Sequence: CAGGACAAAACGGAGGTGTT. Inner Right Sequence: AACAGTGGAACAAAGGACGG. Inner Primer PCR Length: 2808. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1195 C. elegans acr-8(ok1240) X. Show Description
ZC504.2 Homozygous. Outer Left Sequence: tcgaccaatcaaaaatgcaa. Outer Right Sequence: cgcttacgtctgtcgtgcta. Inner Left Sequence: actcagccaacatcgtttcc. Inner Right Sequence: caccaggcaagttgagtgaa. Inner Primer PCR Length: 3051. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1196 C. elegans shn-1(ok1241) II. Show Description
C33B4.3 Homozygous. Outer Left Sequence: AGTGAGAAATGGGGTCGATG. Outer Right Sequence: CCAATTGGACTTACACCGCT. Inner Left Sequence: AGCAAAAATCGGACACAACC. Inner Right Sequence: GCTGTGAACAAGCAAGGACA. Inner Primer PCR Length: 2797. Estimated Deletion Size: about 2300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1197 C. elegans ctl-1(ok1242) II. Show Description
Y54G11A.6 Homozygous. Outer Left Sequence: cggcgattcttatactccca. Outer Right Sequence: attccccgtataccctgacc. Inner Left Sequence: ggccaattttctgcctgata. Inner Right Sequence: gcctgtccaaaataagcgag. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1198 C. elegans Y66D12A.16(ok1243) III. Show Description
Y66D12A.16 Homozygous. Outer Left Sequence: ccattctgcgaggttcttgt. Outer Right Sequence: gtcgttttcgctctttcgtc. Inner Left Sequence: tcatgacgcgttttatccaa. Inner Right Sequence: gtgatcacgtgtacgttggg. Inner Primer PCR Length: 3301. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1199 C. elegans sax-7(ok1244) IV. Show Description
C18F3.2 Homozygous. Outer Left Sequence: accgggttctgctgtgtatc. Outer Right Sequence: gagaccagacaccgcatttt. Inner Left Sequence: tgggaagctccaatgatttc. Inner Right Sequence: atcaaaatttcgcatctggc. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1200 C. elegans hst-3.1(ok1249) II. Show Description
F40H3.5 Homozygous. Outer Left Sequence: ATGCACGTGTTCCTCCTTTC. Outer Right Sequence: ACCACCAAACGGTAATGGAA. Inner Left Sequence: TTAAAGCCGATGGGAATCTG. Inner Right Sequence: TAGAGACGAGCAGAGCGTGA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1201 C. elegans F38H12.3(ok1250) V. Show Description
F38H12.3 Homozygous. Outer Left Sequence: tacaatcatggttccgggtt. Outer Right Sequence: tttgatgctcggtcattttg. Inner Left Sequence: cccaaccgactactctcgaa. Inner Right Sequence: ttgaacggatcgcttacaca. Inner Primer PCR Length: 2951. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1202 C. elegans ZK265.1(ok1251) I. Show Description
ZK265.1 Homozygous. Outer Left Sequence: ttgctcaacatcatgcccta. Outer Right Sequence: aatggcggaagtatctgtgg. Inner Left Sequence: tcgaaaatcccaattcaacc. Inner Right Sequence: gagccgatgttttcaagctc. Inner Primer PCR Length: 2972. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1203 C. elegans T10B11.2(ok1252) I. Show Description
T10B11.2 Homozygous. Outer Left Sequence: GGTTCGGCAAAGCACATAAT. Outer Right Sequence: TAACAACGGCATTGAATGGA. Inner Left Sequence: TCATTCCGACGGTACCATTT. Inner Right Sequence: TGAAGCTTGAAATGCAGTGG. Inner Primer PCR Length: 2465. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1204 C. elegans old-2(ok1253) II. Show Description
ZK938.5 Homozygous. Outer Left Sequence: GCTGTCCCATACGGTTTGAT. Outer Right Sequence: TATTAGCCACGCCCACTTTC. Inner Left Sequence: AGGGAAGAAAATCAGCAGCA. Inner Right Sequence: TTGCTTTGCTTCATGCTACG. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1205 C. elegans R09B5.1(ok1254) V. Show Description
R09B5.1 Homozygous. Outer Left Sequence: ctcattgacttccgggacat. Outer Right Sequence: aatatttttggggaaaggcg. Inner Left Sequence: ctcctcttcctcgtcctcct. Inner Right Sequence: agctttgcagttccggttta. Inner Primer PCR Length: 3218. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1206 C. elegans rsks-1(ok1255) III. Show Description
Y47D3A.16 Homozygous. Outer Left Sequence: gagatgcggaagctatgctc. Outer Right Sequence: gttgaattcctgctcctcca. Inner Left Sequence: attcaactgtgtgccagtgc. Inner Right Sequence: tggggcttcactatttggtc. Inner Primer PCR Length: 3267. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1207 C. elegans cpi-2(ok1256) V. Show Description
R01B10.1 Homozygous. Outer Left Sequence: attccgataacattggctgg. Outer Right Sequence: aatctgttgccgacaaaacc. Inner Left Sequence: attttctggccaatttcgtg. Inner Right Sequence: ccacaattccaatcccaatc. Inner Primer PCR Length: 2103. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1208 C. elegans mrt-2(ok1260) III. Show Description
Y41C4A.14 Homozygous. Outer Left Sequence: tcacgcaatcagtgagcttc. Outer Right Sequence: accgagcattttattcgacg. Inner Left Sequence: gtgcgatggcctacaaaact. Inner Right Sequence: ctcggggatcgaacattaaa. Inner Primer PCR Length: 3107. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1209 C. elegans brc-1(ok1261) III. Show Description
C36A4.8 Homozygous. Outer Left Sequence: aagccaatgaactggtggtc. Outer Right Sequence: tttgtgtgcaaacaccgatt. Inner Left Sequence: gttgagaccgcagaaatcgt. Inner Right Sequence: caaaccgacacaaaatcacg. Inner Primer PCR Length: 2392. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1210 C. elegans nob-1(ok1266) III. Show Description
Y75B8A.2 Homozygous. Outer Left Sequence: TGGTGCCAAAATGATAGCAA. Outer Right Sequence: TTTTCTCAGTGGGTCTCGCT. Inner Left Sequence: TTTTCGAGTTCGTTTTGGCT. Inner Right Sequence: CGATATCGAGATTAGCGGGA. Inner Primer PCR Length: 2924. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1211 C. elegans C34G6.5(ok1267) I. Show Description
C34G6.5 Homozygous. Outer Left Sequence: ccgtatcacacactcatcgg. Outer Right Sequence: attgctaaaacccgcagaaa. Inner Left Sequence: agaaggacaactggctccaa. Inner Right Sequence: caacacagcaagcgagaaaa. Inner Primer PCR Length: 2678. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1212 C. elegans K07D4.5(ok1268) II. Show Description
K07D4.5 Homozygous. Outer Left Sequence: caggaagaggggaaacatca. Outer Right Sequence: ttttgggaggcatgaatagg. Inner Left Sequence: gggtacatccattgccattc. Inner Right Sequence: gcacccgacattttcagttt. Inner Primer PCR Length: 3286. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1213 C. elegans fkb-4(ok240) V. Show Description
ZC455.10 Homozygous. Outer Left Sequence: GGATAATCGTTGCAGCTGGT. Outer Right Sequence: AACACAAGGCATTTTCGGTC. Inner Left Sequence: TCGAAGAAAAGACGAGCACC. Inner Right Sequence: CAGGAATCACAGCGTCGATA. Inner Primer PCR Length: 3198. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1214 C. elegans xpo-3(ok1271) IV. Show Description
C49H3.10 Homozygous. Outer Left Sequence: ATTTAGTTGGAGTGGGTGCG. Outer Right Sequence: GGCGATAGCACGAACTCTTC. Inner Left Sequence: ATCAGAATCGATTTGCGAGC. Inner Right Sequence: CGCTGATATCTTGCGAACAA. Inner Primer PCR Length: 2251. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1215 C. elegans old-1(ok1273) II. Show Description
C08H9.5 Homozygous. Outer Left Sequence: AGACCCACAAGTTTTGTCGC. Outer Right Sequence: GAATTCCCTGGTGAACGAGA. Inner Left Sequence: TGTTGTGGACGGAACGTAAA. Inner Right Sequence: ATCAGCGCATTCGATCTTCT. Inner Primer PCR Length: 2643. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1217 C. elegans F25G6.2(ok1233) V/nT1 [qIs51] (IV;V). Show Description
F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1218 C. elegans F56B3.9(ok1275) IV. Show Description
F56B3.9 Homozygous. Outer Left Sequence: taagagagcggacgcatttt. Outer Right Sequence: gttaacggaatttcggggtt. Inner Left Sequence: cgtggaggacgatctgaaat. Inner Right Sequence: attcgactgccagtgagctt. Inner Primer PCR Length: 2116. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1219 C. elegans ZC449.3a(ok1276) X. Show Description
ZC449.3a Homozygous. Outer Left Sequence: aagaaatagaggcggtcggt. Outer Right Sequence: ggtgcatgggaatttgtttc. Inner Left Sequence: tttcaaccacacgccaaata. Inner Right Sequence: aagttgagacggacgaggaa. Inner Primer PCR Length: 2725. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1220 C. elegans chp-1(ok1277) I. Show Description
Y110A7A.13 Y110A7A.12 Homozygous. Outer Left Sequence: gaccgggtagtttttgcgta. Outer Right Sequence: ggtccgtatttccatgatgc. Inner Left Sequence: gaaacacacaggaacgggat. Inner Right Sequence: aggatgtacgcgtggaaaac. Inner Primer PCR Length: 3175. Estimated Deletion Size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1221 C. elegans his-74(ok1219) V/nT1 [qIs51] (IV;V). Show Description
W05B10.1 Heterozygotes are WT and GFP+. Outer Left Sequence: ttggcttatcggacagatcc. Outer Right Sequence: gtgagctcgtaatatccggc. Inner Left Sequence: aaaatgagaattgatcgcgg. Inner Right Sequence: accttgtgtgatttgcgatg. Inner Primer PCR Length: 2255. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1222 C. elegans R09B5.1(ok1280) V. Show Description
R09B5.1 Homozygous. Outer Left Sequence: ctcattgacttccgggacat. Outer Right Sequence: aatatttttggggaaaggcg. Inner Left Sequence: ctcctcttcctcgtcctcct. Inner Right Sequence: agctttgcagttccggttta. Inner Primer PCR Length: 3218. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1223 C. elegans sph-1(ok1199) IV/nT1 [qIs51] (IV;V). Show Description
F42G8.10 Heterozygotes are WT and GFP+. Outer Left Sequence: aaagtgaacagcaggccaac. Outer Right Sequence: attgtccatcccatcgaaga. Inner Left Sequence: aggaaaccatggctttaggc. Inner Right Sequence: gcttgtgctttcgactttcc. Inner Primer PCR Length: 2101. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1224 C. elegans C34G6.2(ok1227) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34G6.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: agatgggatgatggagcaag. Outer Right Sequence: caagaggtccggatcaaaag. Inner Left Sequence: gctgaggttgcttaggttgc. Inner Right Sequence: atctccgaaatcgtcacgtc. Inner Primer PCR Length: 3245. Estimated Deletion Size: about 2250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1225 C. elegans pxf-1(ok1186) IV/nT1 [qIs51] (IV;V). Show Description
T14G10.2a Heterozygotes are WT and GFP+. Outer Left Sequence: ttgaaatttcgaagatcccg. Outer Right Sequence: catgcccgattatctccact. Inner Left Sequence: acccaccacatttcacgatt. Inner Right Sequence: ttcgattgaccctcatctcc. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1226 C. elegans acr-18(ok1285) V. Show Description
F28F8.1 Homozygous. Outer Left Sequence: tcccacatctctcacccttc. Outer Right Sequence: gcactctccgctcatctctc. Inner Left Sequence: gtgctcttcaccgaatccat. Inner Right Sequence: atgtcaaagaaatccgaccg. Inner Primer PCR Length: 3125. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1227 C. elegans Y49E10.20(ok1286) III. Show Description
Y49E10.20 Homozygous. Outer Left Sequence: cttcttttcgcgtgctctct. Outer Right Sequence: gacaagactagtccgccagc. Inner Left Sequence: gcgggatttcgtcaaaataa. Inner Right Sequence: tcagcaagattttctcggct. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1228 C. elegans arx-2(ok1269) V/nT1 [qIs51] (IV;V). Show Description
K07C5.1 Heterozygotes are WT and GFP+. Outer Left Sequence: tccaatttggcttcaacaca. Outer Right Sequence: catcgacttccgcgtatttt. Inner Left Sequence: tttgaatgagagtgggggag. Inner Right Sequence: ttttcaggcgaaatggattc. Inner Primer PCR Length: 2734. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1229 C. elegans cyc-1(ok1258) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1230 C. elegans F49D11.9(ok1190) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F49D11.9 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: aattgccaactgccgattat. Outer Right Sequence: tcggggagtacacaggctac. Inner Left Sequence: aagaacttcagagttgccgc. Inner Right Sequence: cgagctccataaaatcgcat. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1231 C. elegans pde-4(ok1290) II. Show Description
R153.1a Homozygous. Outer Left Sequence: acagcaccggcaaatatagc. Outer Right Sequence: tcgacacgctaatcgaagtg. Inner Left Sequence: agcagaacgtgcattgactg. Inner Right Sequence: ttgagcttccagacgatgtg. Inner Primer PCR Length: 3136. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807