| PS8643 |
C. elegans |
syIs673; syIs300. Show Description
syIs673 [rig-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for SAA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8648 |
C. elegans |
syIs678; syIs300. Show Description
syIs678 [flp-8p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8650 |
C. elegans |
syIs680; syIs300. Show Description
syIs680 [gcy-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASEL neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8653 |
C. elegans |
syIs683; syIs300. Show Description
syIs683 [gcy-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASE neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8660 |
C. elegans |
syIs690; syIs300 Show Description
syIs690 [tph-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR +pdf-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. [NOTE: Pick animals with RFP+ coelomocytes to maintain. Array appears to be lost or silenced in some animals.] Split cGAL driver for NSM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8661 |
C. elegans |
syIs691; syIs300. Show Description
syIs691 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + grl-2p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for MCM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8674 |
C. elegans |
nlp-6(sy1449) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-6.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GCGACTCGCCTTCGTTCTTCTCGTCTCGGCGTGCG
right flanking sequence: TCATGGCAATGGCTGCTCCAAAACAAATGGTGTTC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTCGTCTCGGCGTGCGTCA
Method Reference: G3 (Bethesda).
|
|
| PS8676 |
C. elegans |
nlp-9(sy1451) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-9.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: gaaaaaaagagagATGGATCGATTCGCCACCAGAT
right flanking sequence: TTATCGCCCTTCTTCTGGTTCTTTTACAAATTGgtg
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGAAGAAGGGCGATAAATC
Method Reference: G3 (Bethesda).
|
|
| PS8678 |
C. elegans |
nlp-13(sy1453) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-13.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CGATCTCTTCAGATCTTCTGCATCATGTCCGCCA
right flanking sequence: TCGCAATGGCATACAGTCAAGgtttgtgttgtgtc
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTGTATGCCATTGCGATGG
Method Reference: G3 (Bethesda).
|
|
| PS8680 |
C. elegans |
nlp-16(sy1455) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-16.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CTCTTTCCCCATTGGAAAAGACAATGAATCCGACG
right flanking sequence: AGTCCGAAGTTGAAGTGGATACCACAACTGAAGCTG
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTTCAACTTCGGACTCGT
Method Reference: G3 (Bethesda).
|
|
| PS8682 |
C. elegans |
nlp-19(sy1457) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-19.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: ctctactgttgtatattcttcttcacaATGCTCTT
right flanking sequence: ACGCGGTGTATGCCTTGCTCTTCTCATTCTAGTCAC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTTCACAATGCTCTTACG
Method Reference: G3 (Bethesda).
|
|
| PS8687 |
C. elegans |
nlp-32(sy1459) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-32.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GCTACTTGTATTCTGTCTTATCGCATTGACCGCCT
right flanking sequence: TGCCGGTTTTCTCTTTTCCAAATGGGCTAACTATG
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGAGAAAACCGGCAAGG
Method Reference: G3 (Bethesda).
|
|
| PS8689 |
C. elegans |
nlp-33(sy1461) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-33.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GCTTCTCTTTGCCATATTGGCTATCGTTGATGCCCA
right flanking sequence: GTGGGGATgtaagttttcaataacttgtttctg
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTATCGTTGATGCCCAGTG
Method Reference: G3 (Bethesda).
|
|
| PS8691 |
C. elegans |
nlp-43(sy1463) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-43.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: gctcggaagtATGTCGTTGGCTCAATCTACCTTCT
right flanking sequence: ACCTTCTATTTGTTGCATTTTTGGCAGTTGTGATC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACAAATAGAAGGTAGA
Method Reference: G3 (Bethesda).
|
|
| PS8693 |
C. elegans |
nlp-73(sy1465) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-73.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GGTGCTCATCGCGACCACTGTGCTCATCGCCGAGT
right flanking sequence: CTCGTGTATTCTATAACCGATTCGACGGCGGGCTC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATAGAATACACGAGACT
Method Reference: G3 (Bethesda).
|
|
| PS8769 |
C. elegans |
syIs695. Show Description
syIs695 [trx-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons.
|
|
| PS8834 |
C. elegans |
syIs696; syIs300. Show Description
syIs696 [nlp-56p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RMG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8839 |
C. elegans |
syIs700; syIs300 Show Description
syIs700 [nlp-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for PVQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8843 |
C. elegans |
syIs704; syIs300. Show Description
syIs704 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + mbr-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for AIM neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8844 |
C. elegans |
syIs705; syIs300. Show Description
syIs705 [gcy-32p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AQR, PQR, and URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8846 |
C. elegans |
syIs707; syIs300. Show Description
syIs707 [osm-10p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, srb-6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for PHA and PHB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8849 |
C. elegans |
syIs710; syIs300. Show Description
syIs710 [srg-13p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8872 |
C. elegans |
syIs716; syIs300. Show Description
syIs716 [klp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL2 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9030 |
C. elegans |
syIs742; syIs300. Show Description
syIs742 [Y41C4A.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9031 |
C. elegans |
syIs743; syIs300. Show Description
syIs743 [pks-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for CAN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9034 |
C. elegans |
syIs686. Show Description
syIs686 [gpa-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASI neurons.
|
|
| PS9035 |
C. elegans |
syIs734. Show Description
syIs734 [sre-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADL neurons.
|
|
| PS9229 |
C. elegans |
syIs748; syIs300. Show Description
syIs748 [tbh-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9232 |
C. elegans |
syIs751; syIs300. Show Description
syIs751 [ttr-39p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DD and VD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9235 |
C. elegans |
syIs768; syIs300. Show Description
syIs768 [aqp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL1 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9435 |
C. elegans |
syIs788. Show Description
syIs788 [srt-28p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC-OFF neuron.
|
|
| PS9441 |
C. elegans |
syIs794; syIs337. Show Description
syIs794 [F47D2.11::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
|
|
| PS9443 |
C. elegans |
syIs796; syIs300. Show Description
syIs796 [F35D11.1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, F09E10.7p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for CEP neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9445 |
C. elegans |
syIs798. Show Description
syIs798 [srt-47p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC-ON neuron.
|
|
| PS9520 |
C. elegans |
nlp-21(sy1807) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaaattgatactatgaaacattatatttccagCG right flanking sequence: CTTGTCATGGTGCTCAACGCCCAATACACTTCCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAGCACCATGACAAGCGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS9529 |
C. elegans |
him-5(e1490) V; nlp-49(sy1815) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-49 into parental strain CB4088. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGCTTTTGGCTGTTTTCTGCATTGCTGCCTAT. Right flanking sequence: CCTGGGCTGATGGGgtatgttccaatattgaacc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGCATTGCTGCCTATGCCT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS9534 |
C. elegans |
syIs799; syIs300. Show Description
syIs799 [F58F6.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9542 |
C. elegans |
syIs807; syIs337. Show Description
syIs807 [pps-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
|
|
| PS9547 |
C. elegans |
syIs812; syIs337. Show Description
syIs812 [srj-26p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
|
|
| PS9550 |
C. elegans |
syIs815; syIs337. Show Description
syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
|
|
| PS9551 |
C. elegans |
syIs816; syIs300. Show Description
syIs816 [ocr-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for OLQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9594 |
C. elegans |
nlp-8(sy1844) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gttttcagTGCCTTCTTATCGGCTTTACTGCCGCCT. Right flanking sequence: ACCCCTACCTGATCTTTCCTGCTTCACCGTCCTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAGATCAGGTAGGGGTAGG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS9663 |
C. elegans |
syEx1708; syIs300. Show Description
syEx1708 [dat-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for dopaminergic neurons (CEP, ADE, PDE). syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9664 |
C. elegans |
syIs300; syEx1709. Show Description
syEx1709 [arrd-16p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. cGAL driver for URY neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS9665 |
C. elegans |
syIs300; syEx1711. Show Description
syEx1711 [nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
|
|
| PS9666 |
C. elegans |
syIs300; syEx1712. Show Description
syEx1712[T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
|
|
| PS9668 |
C. elegans |
syIs300; syEx1714. Show Description
syEx1714 [flp-11p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, seb-3p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for OLL neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
|
|
| PS9675 |
C. elegans |
syIs840; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs840 [T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
|
|
| PS9676 |
C. elegans |
syIs841; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs841 [nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
|
|
| PS9893 |
C. elegans |
syIs844; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs844 [srd-36p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ASK neurons.
|
|