| MT16231 |
C. elegans |
nIs177 sptf-3(n4850) I. Show Description
nIs177 [ceh-28p::4NLS::GFP + lin-15(+)]. Extra ceh-28p::4NLS::GFP-expressing M4 seen in nIs177 (~30% penetrance). Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
|
|
| MT19851 |
C. elegans |
sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. Show Description
nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
|
|
| NK885 |
C. elegans |
unc-119(ed4) III; qyIs174. Show Description
qyIs174 [hlh-2p::GFP::hlh-2 + unc-119(+)]. Translational fusion protein displaying cytoplasmic and nuclear localization; contains 8 kb upstream, N-terminal GFP fusion, full open reading frame and 3'UTR. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
|
|
| NK887 |
C. elegans |
unc-119(ed4) III; qyIs176. Show Description
qyIs176 [zmp-1(50-51)p::mCherry::moeABD + unc-119(+)]. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
|
|
| OD4467 |
C elegans |
ltSi220 I; ltSi1232 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OD4495 |
C elegans |
ltSi569 I; ltSi1539 II; unc-119(ed3) III. Show Description
ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1539 [spd-2p::GFP::spd-5 S170A T178A T198A::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled microtubules. GFP-labeled centrosomes. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OD4833 |
C elegans |
ltSi220 I; ltSi1561 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1561 [spd-2p::spd-5(S170A T178A T198A S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OH16144 |
C. elegans |
nIs175 IV. Show Description
nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. GFP expression in M4 neurons can be used to isolate M4 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH3701 |
C. elegans |
otIs173 III. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3pB::GFP].
|
|
| OH4134 |
C. elegans |
otIs173 III; zdIs13 IV. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV.
|
|
| OH4135 |
C. elegans |
otIs173 III; zdIs13 IV; wrk-1(ok695) X. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV.
|
|
| OH7074 |
C. elegans |
otIs173 III; ttx-3(ot355) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
|
|
| OH7075 |
C. elegans |
otIs173 III; ttx-3(ot356) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
|
|
| OH7076 |
C. elegans |
otIs173 III; ttx-3(ot357) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
|
|
| OH7079 |
C. elegans |
otIs173 III; ttx-3(ot360) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
|
|
| OH7103 |
C. elegans |
otIs173 III; ttx-3(ot365) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
|
|
| OH9330 |
C. elegans |
hlh-3(ot354) II; otIs173 III. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
|
|
| OP171 |
C. elegans |
unc-119(ed3) III; wgIs171. Show Description
wgIs171 [egl-38::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP174 |
C. elegans |
unc-119(ed3) III; wgIs174. Show Description
wgIs174 [ces-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP175 |
C. elegans |
unc-119(ed3) III; wgIs175. Show Description
wgIs175 [lir-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP177 |
C. elegans |
unc-119(ed3) III; wgIs177. Show Description
wgIs177 [egl-27::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of egl-27 coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP178 |
C. elegans |
unc-119(ed3) III; wgIs178. Show Description
wgIs178 [skn-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of skn-1 coding sequence of fosmid ID#WRM0641aG02 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP179 |
C. elegans |
unc-119(ed3) III; wgIs179. Show Description
wgIs179 [gei-11::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP217 |
C. elegans |
unc-119(ed3) III; ddIs172. Show Description
ddIs172 [aly-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OS1776 |
C. elegans |
hsf-1(sy441) I; nsEx992. Show Description
nsEx992 [vap-1::hsf-1 + hsp::FRT-GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in amphid sheath cells and occasionally gut following heat shock. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
|
|
| PS1702 |
C. elegans |
dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS4997 |
C. elegans |
unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC.
|
|
| RT476 |
C. elegans |
unc-119(ed3) III; pwIs170. Show Description
pwIs170 [vha6p::GFP::rab-7 + Cbr-unc-119(+)].
|
|
| RW10006 |
C. elegans |
unc-119(ed3) ruIs32 III; zuIs178 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. Ubiquitous histone-GFP fusion protein in embryo and adult germline as well as many adult somatic cells.
|
|
| RW10007 |
C. elegans |
pha-1(e2123) stIs10007 III; zuIs178 V. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10007 [pha-4 (4.1kb)) H3::H3::GFP::H3 3'UTR + pie-1p::H2B::GFP::pie-1 3'UTR + pha-4p::H1::DsRed::T1::let-858 3'UTR]. May still contain ruIs32 [pie-1::H2B-GFP + unc-119(+)] in the background.
|
|
| RW10029 |
C. elegans |
zuIs178; stIs10024. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. May still have unc-119(ed3) in the background.
|
|
| RW10048 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10044. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10044 [mir-57::HIS-24::mCherry + unc-119(+)].
|
|
| RW10060 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10060. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10060 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)].
|
|
| RW10062 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10050. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10050 [pha-4(4kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
| RW10064 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10064. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10064 [end-3::H1-wCherry::let-858 3' UTR + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
| RW10083 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10059. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10059 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
| RW10084 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10039. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10039 [mir-61::H1.1-GFP::let-858 3' UTR + unc-119(+)].
|
|
| RW10097 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10088. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10088 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
| RW10098 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10035. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10035 [eft-3-L2::H1-wCherry + unc-119(+)].
|
|
| RW10108 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10086. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10086 [ges-1::H1-wCherry + unc-119(+)].
|
|
| RW10131 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10131. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10131 [elt-7::H1-wCherry + unc-119(+)].
|
|
| RW10166 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10157. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10157 [dpy-7::H1-wCherry + unc-119(+)].
|
|
| RW10174 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10174. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10174 [pal-1::H1-wCherry + unc-119(+)].
|
|
| RW10175 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10138. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10138 [tbx-38::H1-wCherry + unc-119(+)].
|
|
| RW10177 |
C. elegans |
unc-119(ed3) III; zuIs178; stIs10177. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10177 [cwn-1::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
|
|
| RW10196 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10122. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10122 [hnd-1::MycCherry I (modENCODE39) + unc-119(+)].
|
|
| RW10197 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10137. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10137 [med-2::H1-wCherry + unc-119(+)].
|
|
| RW10199 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10140. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10140 [vab-7::H1-wCherry + unc-119(+)].
|
|
| RW10206 |
C. elegans |
unc-119(ed3) III; zuIs178; stIs10308. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10308 [die-1::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
|
|
| RW10230 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10224. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10224 [lin-39::H1-wCherry + unc-119(+)].
|
|
