Search Strains

More Fields
Strain Species Genotype Add
RG3294 C. elegans clec-57(ve794[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1424bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGATTCTTCTCCCCATTTTCCTGCTTTTCA ; Right flanking sequence: GGGGATTTGAATCGTCTACAAACATGATGA. clec-57 crRNA A: GCATTATTGGACTTTCAGgt; clec-57 crRNA B: ATCTTCATACAATTTGGCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3295 C. elegans Y53G8AL.1(ve795[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 6742 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGGAGAACGACTATTGGAAGTGCTCCG ; Right flanking sequence: cggaatcggaaaattcagaaaatttcagtt. sgRNA #1: TTGAGCACCACATCACAGGT; sgRNA #2: aaatcatgttacagctgtag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3296 C. elegans T20D3.6(ve796[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagaacattttatgaatcaaaagTTAAGCA ; Right flanking sequence: CGGAAGTCATGTGGCTCGGCGTTCATtttt. sgRNA #1: GAATTATTCTGAGGAACCGC; sgRNA #2: TTATATGCGCTTTGTGATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3297 C. elegans +/nT1[umnIs49] IV; F25H9.6(ve797[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Sterile. Deletion of 1068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve797 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aatagaagaaaaatatgatattgtCTACCC ; Right flanking sequence: AATTCGTCGGACATgttaaccgaacaagtt. sgRNA #1: AGGCAGTTCGCATCCAATGC; sgRNA #2: ATCAGTGAAAAGGCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3298 C. elegans M05D6.5(ve798[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1412 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gagagaaagtatacaatttatTCATTTCTG ; Right flanking sequence: ACGGAACATGCCCATtttgtgtgaagagag. sgRNA #1: GTGCTCCTCATCTTCATACG; sgRNA #2: ACAGCTTTCATGAACGTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3299 C. elegans wbp-2(ve799[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1296 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve799 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccacttgtttaatttatatttagATGTC ; Right flanking sequence: TAActtgtaaatttaacaacaaaaaatgac. sgRNA #1: CATCAACACGGCGAACACGC; sgRNA #2: ATTTCTTCGCCTCAATCCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.