| VC1113 |
C. elegans |
R01H10.6(gk507) III. Show Description
R01H10.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4000 |
C. elegans |
oig-5(gk5072[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTTCTCTGGTGGTAGCGATGATGGTAGAA; Right flanking sequence: GGCTGAAATCAATGCGTGGTAGCCTAAAGA. See WormBase Variation gk5072 for details.
|
|
| VC4001 |
C. elegans |
Y55F3AM.11(gk5073) IV. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
|
|
| VC4002 |
C. elegans |
C06E2.9(gk5074) C05G5.3(gk5075) X. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
|
|
| VC4003 |
C. elegans |
F54D1.1(gk5076[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCAAGTCAATATTTTCATTATTTCCTCAT; Right flanking sequence: ATTTGTTACTGAAATCTCAGATAACAATGC. See WormBase Variation gk5076 for details.
|
|
| VC4006 |
C. elegans |
igeg-1(gk5079[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|