| QC119 |
C. elegans |
ech-7(et6) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. ech-7(et6) suppresses the cold-adaptation defect of paqr-2(tm3410) and partially suppresses the tail tip defect. ech-7(et6); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
| ET65 |
C. elegans |
cul-2(ek1)/unc-64(e246) III. Show Description
Heterozygotes are WT and segregate WT, Unc and adult steriles (cul-2 homozygotes). cul-2 homozygotes have large germ cells and lay few eggs (slightly temperature sensitive, with more eggs at lower temperatures) that arrest early in development with multiple nuclei.
|
|
| JCB418 |
C. elegans |
Y67H2A.2(bet63) IV. Show Description
Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.
|
|
| JCB419 |
C. elegans |
Y76A2B.4(bet65) III. Show Description
Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg.
|
|
| JCB426 |
C. elegans |
chil-11(bet66) IV. Show Description
Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.
|
|
| JCB434 |
C. elegans |
K04C2.8(bet68) III. Show Description
Homozygous viable. Deletion of 796 bp in parental strain N2, with insertion of 13 nucleotides(tcaacaaaatgcc) at break. Left flanking sequence: taatatcctccggaccgata; Right flanking sequence: gtcctgactgataatcatcaac. sgRNA #1: tgtgtagtataaacgattat; sgRNA #2: cgggtcacgagtagagatgg.
|
|
| QC162 |
C. elegans |
fat-2(wa17) IV; egl-9(et60) V. Show Description
egl-9(et60) is a 1670G>A (Arg557His) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC164 |
C. elegans |
fat-2(wa17) IV; egl-9(et62) V. Show Description
egl-9(et62) is a 1669C>T (Arg557Cys) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC165 |
C. elegans |
fat-2(et63wa17) IV. Show Description
fat-2(et63) is a 73G>A (Val25Met) substitution mutation and intragenic fat-2(wa17) suppressor. This strain still carries the fat-2(wa17) S101F substitution mutation. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC166 |
C. elegans |
fat-2(et64wa17) IV. Show Description
fat-2(et64) is a 296C>T (Ser99Leu) substitution and intragenic fat-2(wa17) suppressor. This allele still carries the fat-2(wa17) S101F substitution mutation. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC169 |
C. elegans |
ftn-2(et67) I; fat-2(wa17) IV. Show Description
ftn-2(et67) is a 267G>A (Trp89*) nonsense mutation and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC170 |
C. elegans |
ftn-2(et68) I; fat-2(wa17) IV. Show Description
ftn-2(et68) is a 409C>T (Gln137*) nonsense mutation and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC171 |
C. elegans |
fat-2(wa17) IV; hif-1(et69) V. Show Description
hif-1(et69) is a 1241-1G>A splice acceptor variant and gain-of-function allele that acts as a suppressor of the fat-2(wa17) growth defects. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
