| CB538 |
C. elegans |
unc-1(e538) X. Show Description
Recessive. Kinker Unc.
|
|
| GS1214 |
C. elegans |
sel-12(ar171) unc-1(e538) X. Show Description
Egl. Unc. Do not distribute this strain; other labs should request it from the CGC.
|
|
| RG3038 |
C. elegans |
C26D10.3(ve538[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1301 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tctcgagtaattcgtatcctgcgaataaat ; Right flanking sequence: CAAGGAGAAGTGTGTGGAAGAGCGATGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| SP1022 |
C. elegans |
mnDp65 (X;I); unc-1(e538) X. Show Description
WT.
|
|
| SP1023 |
C. elegans |
mnDp68 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs. Maintain by picking WT.
|
|
| SP1024 |
C. elegans |
mnDp70 (X;V); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1025 |
C. elegans |
mnDp69 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1027 |
C. elegans |
mnDp66 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1031 |
C. elegans |
mnDp67 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1053 |
C. elegans |
mnDp71 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs. Maintain by picking WT.
|
|
| SP1085 |
C. elegans |
mnDp73 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs.
|
|
| SP934 |
C. elegans |
unc-1(e538) dpy-3(e27) X. Show Description
DpyUnc.
|
|
| SP940 |
C. elegans |
unc-52(e444) II; unc-1(e538) X; mnDp11 (II;X;f). Show Description
Maintain strain by picking WT. Throws WT and Unc.
|
|
| SP965 |
C. elegans |
mnDp63 (X;I); unc-1(e538) X. Show Description
WT phenotype.
|
|
