Strain Information
| Name | RG3583 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | aipr-1(ve1083[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. |
| Description | umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect lethal. Deletion of 1503 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 hermaphrodites that produce broods of dumpy progeny that arrest (ve1083 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GTTGCGCAGCAGCAGTTTGAGGTCTTCTTC; Right flanking sequence: CACAGTTGCTCTGACCGACATtctgaaaat. aipr-1 crRNA A: TGCctggaatcgattatggg; aipr-1 crRNA B: GTAAAACGGACAATCAGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| Mutagen | Crispr/Cas9 |
| Made by | RG KO Group |
| Laboratory | RG |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.