Variation Information: km16
| Name | km16 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | IV:-3.12 +/- 0.003 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | Deletion |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| KB7 | kgb-1(um3) kgb-2(km16) IV. | C. elegans | Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)] |