Gene Information: kgb-1
| Name | kgb-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T07A9.3 |
| Genetic position | IV:-26.11 +/- 0.025 cM |
| Genomic position | IV: 405621..410035 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| KB3 | kgb-1(um3) IV. | Temperature sensitive sterile at 26C, with EMO oocytes. Grows at 15C or 20C. |
| KB7 | kgb-1(um3) kgb-2(km16) IV. | Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)] |
| KU21 | kgb-1(km21) IV. | Sensitive to heavy metal stress. |