Gene Information: kgb-2

Strains carrying this gene

Strain	Genotype	Description
KB7	kgb-1(um3) kgb-2(km16) IV.	Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]
VC822	kgb-2(gk361) IV.	ZC416.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807